Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of linc00084 in the preparation of adjuvant drugs for hypoxic tumor radiotherapy

A tumor radiotherapy and drug technology, applied in the field of biomedicine, can solve the problems of high cost and high cost of heavy ion accelerators, and achieve the effect of increasing tumor cure rate, accelerating extinction, and improving prognosis

Active Publication Date: 2022-03-29
SUZHOU UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The emergence of heavy ion radiotherapy has significantly improved the cure rate of some malignant tumors and improved the prognosis of patients; however, heavy ion radiotherapy is a very expensive treatment because the cost of manufacturing heavy ion accelerators is very high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of linc00084 in the preparation of adjuvant drugs for hypoxic tumor radiotherapy
  • Application of linc00084 in the preparation of adjuvant drugs for hypoxic tumor radiotherapy
  • Application of linc00084 in the preparation of adjuvant drugs for hypoxic tumor radiotherapy

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] The expression of LINC00084 was up-regulated after heavy ion irradiation. Through biological sequencing and bioinformatics analysis, it was found that it can promote the expression of pro-apoptotic gene PDCD4 in tumor cells, thereby increasing the apoptosis of tumor cells. The nucleotide sequence of LINC00084 (ENST00000645023.1; chr11:65423125-65426499Homo sapiens) is as follows:

[0029]TGTGTGGAAGGAGGAAGGCAGGGAGAGGTAGAAGGGGTGGAGGAGTCAGGAGGAATAGGCCGCAGCAGCCCTGGAAATGATCAGGAAGGCAGGCAACCAAGGGCTGTGAACCCGCCTGGGGATGAGGCCTGGTCTTGTGGAACTGAACTTAGCTCGACGGGGCTGACCGCTCTGGCCCAGGGTGGTATGTAATTTTCGCTCGGCCTGGGACGGGGCCCAGGCCGGGCCCAGCCTGGTGGAGCGTCCAGGTCTGGGTGCGAAGCCAGGCCCCTGGGCGGAGGTGAGGGGTGGTCTGAGGAGTGATGTGGAGTTAAGGCGCCATCCTCACCGGTGACTGGTGCGGCACCTAGCATGTTTGACAGGCGGGGACTGCGAGGCACGCTGCTCGGGTGTTGGGGACAACATTGACCAACGCTTTATTTTCCAGGTGGCAGTGCTCCTTTTGGACTTTTCTCTAGGTTTGGCGCTAAACTCTTCTTGTGAGCTCACTCCACCCCTTCTTCCTCCCTTTAACTTATCCATTCACTTAAAACATTACCTGGTCATCTGGTAAGCCCGGGACAGTAAGCCGAGTGGCTGTTGGAGTCGGTATTGT...

Embodiment 2

[0030] Example 2 The Effect of Irradiation on the Expression of LINC00084

[0031] (1) Cell culture

[0032] The stable lung cancer cell line A549 cells were selected and cultured with RPMI-1640 complete medium at a constant temperature of 37°C and 5% CO 2 Cultured in a cell incubator; wash the cells with sterile PBS 2-3 times, and then digest with 0.25% trypsin for 1-2min. Resuspend RPMI-1640 complete medium; divide into new culture dishes, add RPMI-1640 complete medium for expanded culture, do not add hypoxic condition treatment during normal culture of cells, only perform hypoxic treatment before irradiation, and After irradiation, culture under hypoxic conditions was continued for subsequent experiments.

[0033] The hypoxic culture of cells adopts the ratio of 5% carbon dioxide, 94% nitrogen, and 1% oxygen for hypoxic culture, and the temperature is 37°C. Before the cells are irradiated, the cells with a suitable density are put into the hypoxic incubator. After 24 hou...

Embodiment 4

[0056] Example 4 Cell Proliferation Test

[0057] The A549 cells overexpressing LINC00084 were divided into 1×10 4 The density was planted in a 96-well plate, cultured in a hypoxic incubator (5% carbon dioxide, 94% nitrogen, 1% oxygen), and the cell proliferation level was measured every 24 hours. The cell proliferation test adopts the CCK-8 method. Before the test, the original old medium is discarded, and the complete medium containing 10% CCK-8 reagent is prepared, and the amount of 100 μL / well is added to the cells to be tested in the 96-well plate. Afterwards, incubate at 37°C in the dark for 2 hours. After the incubation, measure the absorbance at 450nm on a multi-functional microplate reader. The value of absorbance (OD value) is positively correlated with the level of cell proliferation. The larger the OD value, the more cell proliferation. see results Figure 5 , Figure 5 The results showed that overexpression of LINC00084 significantly inhibited the proliferation...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses the application of LINC00084 in the preparation of auxiliary drugs for hypoxic tumor radiotherapy, and belongs to the technical field of biomedicine. In hypoxic tumor cells, LINC00084 and PDCD4 were significantly up-regulated after carbon ion irradiation compared with X-rays, and bioinformatics analysis showed that there was a ceRNA regulatory relationship between them; experiments showed that the high expression after heavy ion irradiation LINC00084 promotes the expression of the apoptosis-related gene PDCD4 in cells, causing cell apoptosis, thereby accelerating the death of tumor cells. LINC00084 can be used as a new biomolecular target. By up-regulating the expression of LINC00084 during ordinary photon radiotherapy, thereby promoting cell apoptosis, especially for some hypoxic tumor tissues, it can effectively increase the apoptosis level of tumor cells and increase tumor cure rate and improve patient outcomes.

Description

technical field [0001] The present invention relates to the technical field of biomedicine, and more specifically relates to the application of LINC00084 in the preparation of auxiliary drugs for radiotherapy of hypoxic tumors. Background technique [0002] Cancer is the number one killer that threatens human life today, and subject to the current level of scientific and technological development, cancer treatment methods are very limited, including traditional surgery, photon radiotherapy, chemotherapy and targeted gene therapy developed in the past ten years, only The cure rate of a small number of cancers is higher, and the prognosis of patients is better. At present, the prognosis of most cancers is still not satisfactory, and the cure rate of patients is not optimistic; in response to these problems, scientists and clinicians have never given up looking for more effective treatments. [0003] Among them, the emergence of heavy ion radiotherapy has filled the gap for tr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): A61K31/7105A61K35/13A61P35/00
CPCA61K31/7105A61K35/13A61P35/00
Inventor 周光明胡文涛黄皓
Owner SUZHOU UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More