Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction method of immortalized feeder layer cell strain, immortalized feeder layer cell strain and application

A feeder cell and construction method technology, applied in the field of immortalized feeder cell lines and its application, and construction of immortalized feeder cell lines, can solve the problems of low infection rate of primary cells and low success rate of feeder cell immortalization

Pending Publication Date: 2021-06-11
SHENZHEN PEOPLES HOSPITAL
View PDF9 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The success rate of immortalization of feeder cells is low, and the infection rate of primary cells is even lower

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction method of immortalized feeder layer cell strain, immortalized feeder layer cell strain and application
  • Construction method of immortalized feeder layer cell strain, immortalized feeder layer cell strain and application
  • Construction method of immortalized feeder layer cell strain, immortalized feeder layer cell strain and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] This embodiment provides a method for obtaining an immortalized feeder cell line by infecting BMI-1 gene and hTERT gene into feeder cells derived from fibroblasts, which specifically includes the following steps:

[0055] 1.1 Acquisition of recombinant plasmids

[0056] (1) Construction of PLV-EF1a-BMI-1-puro plasmid

[0057] Utilize PCR primers to clone BMI-1 gene from 293T cells, the resulting BMI-1 gene sequence is shown in SEQ ID No.1, and then the gained BMI-1 gene is connected to the PLV-EF1a-Puro lentiviral plasmid to construct PLV- EF1a-BMI-1-puro recombinant plasmid, PLV-EF1a-BMI-1-puro recombinant plasmid map as figure 1 As shown, the specific steps are as follows:

[0058] ①PCR reaction to amplify the target gene

[0059] The above PCR primer sequences are:

[0060] Forward primer sequence: CGGGATCCATGCATCGAACAACGAGAATCAAGA (SEQ ID No.2)

[0061] Reverse primer sequence: TGCTCTAGATCAACCAGAAGAAGTTGCTGATGAC (SEQ ID No.3)

[0062] The PCR reaction system i...

Embodiment 2

[0088] This example provides the application of the immortalized feeder cell line obtained in Example 1 in the functional identification of human primary tissue cells, which specifically includes the following steps:

[0089] The immortalized feeder cell line obtained in Example 1 was treated with 4ug / mL mitomycin and mixed with human primary tissue cells. After the mixed culture, it can successfully provide nutrition for human primary cells and support primary cell growth.

experiment example 1

[0091] The immortalized feeder cell line obtained in Example 1 and the non-immortalized feeder cell line were passaged at the same time, and the maximum number of passages was counted. The results showed that the maximum number of passages of the immortalized cell line obtained in Example 1 could reach more than 25 generations. After 5 generations of non-immortalized feeder cell lines (such as image 3 shown in a), and passed down to the immortalized feeder cell line for 3 generations (such as image 3 shown in b) and 20 generations (such as image 3 Shown in c) the obtained cell line is observed under a microscope, and the results are as follows image 3 As shown in the figure, it can be seen from the figure that the immortalized cells have no difference in cell shape compared with the non-immortalized cells, and the cells are in good condition, and there is no difference between the cell state at the 20th passage and the cell state at the 3rd passage.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of an immortalized feeder layer cell strain, the immortalized feeder layer cell strain and application of the immortalized feeder layer cell strain. At least two immortalized genes are selected to be infected into feeder layer cells, and the two immortalized genes achieve a synergistic promotion effect on feeder layer cell immortalization through different cell immortalization promotion ways, and the immortalized feeder layer cell strain is obtained, so that the blank of a feeder layer cell immortalization method is filled, and wide cell resources are provided for evaluating the effect of treating tumors by drugs or controlling the proliferation of tumor cells and determining the proliferation or aging mechanism of the cells.

Description

technical field [0001] The invention relates to the technical fields of molecular biology and cell culture, in particular to a construction method of an immortalized feeder layer cell line, an immortalized feeder layer cell line and its application. Background technique [0002] Cell immortalization refers to the process in which cells cultured in vitro escape from the crisis of proliferation and senescence spontaneously or affected by external factors, so that they have the ability to proliferate indefinitely. Under normal circumstances, the chance of spontaneous immortalization of cells is very small, 10 in rodents -5 ~10 -6 , while human cells are much rarer, usually less than 10 -12 . [0003] Immortalization of cells is the only way for cells to become cancerous. In order to study and treat tumors, control tumor cell proliferation, and improve organ transplantation methods, human intervention is required to immortalize cells. Cell immortalization is also an importan...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N5/10C12N15/12C12N15/867C12Q1/02
CPCC12N5/0656C12N15/86C07K14/4702C07K14/503C07K14/005C07K14/82C12N9/1276G01N33/5011C12Y207/07049C12N2510/04C12N2740/15043C12N2740/10043C12N2710/22022C12N2503/02G01N2500/10
Inventor 邹畅张荟蓉刘东成
Owner SHENZHEN PEOPLES HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com