Specific gene of pholiota adipose and application of specific gene

Abstract

The invention relates to a specific gene of pholiota adipose and an application of the specific gene, a short sequence of the specific gene is shown as SEQ ID NO.1: ATTGAATTACCTATCCAAGGTGACTTGGGGA, and a method for identifying pholiota adipose molecules by using the specific gene comprises the following steps: (1) extracting genome DNA from a to-be-detected sample tissue; (2) by taking the genome DNA extracted in the step (1) as a template, carrying out polymerase chain reaction by using a pholiota adipose specific primer to obtain an amplified DNA product; (3) sequencing the DNA product obtained by amplification in the step (2); and (4) splicing and proofreading sequencing results to obtain an amplified fragment, detecting whether the specific gene short sequence SEQ ID NO.1 exists in the amplified fragment or not, and identifying the sample as pholiota adipose if the specific gene short sequence SEQ ID NO.1 exists in the amplified fragment. The specific short sequence and the method provided by the invention can be used for rapidly, accurately and accurately identifying the poison mushroom pholiota adiposa from the easily confused edible mushrooms, and the specific short sequence is easy to amplify, simple and convenient to operate and wide in applicability.

Description

technical field [0001] The application belongs to the technical field of identification of poisonous mushrooms, and in particular relates to a specific gene of Amanitia cuspidatum and its application. Background technique [0002] Wild edible fungi are delicious, nutritious and have certain health value, so they are deeply loved by people. However, poisonous mushrooms are often mixed in wild edible mushrooms sold in the market, mainly because edible mushrooms and some poisonous mushrooms are very similar in shape and characteristics, especially after drying, they are mixed together and it is difficult to distinguish them. For example, the mushrooms called "thorn mushrooms" sold in the market actually include a variety of yellow mushrooms with scales on the surface of the cap, such as yellow umbrella Pholiota adiposa, lemon scale umbrella Pholiota limonella, golden hair scale umbrella Pholiota aurivella, etc. However, it is often mixed with the poisonous mushroom Pholiota sq...

AI Technical Summary

Problems solved by technology

However, poisonous mushrooms are often mixed in wild edible mushrooms sold in the market, mainly because edible mushrooms and some poisonous mushrooms are very similar in shape and characteristics, especially after drying, they are mixed together and it is difficult to distinguish

For example, the mushrooms sold in the market called "thorn mushrooms" actually include a variety of yellow mushrooms with scales on the surface of the cap, such as yellow umbrella Pholiota adiposa, lemon scale umbrella Pholiota limonella, golden hair scale umbrella Pholiota aurivella, etc. However, it is often mixed with the poisonous mushroom Pholiota squarrosoides with very similar characteristics such as color and cap scales. It is difficult for non-professional morphological identification experts to distinguish them, and it is easy to be poisoned by mistake. Symptoms are nausea, vomiting, abdominal cramping, diarrhea, which may be accompanied by symptoms such as anxiety, sweating, chills, rapid heartbeat and, in severe cases, muscle cramps, circulatory disturbance, or loss of electrolytes

In addition, due to the lack of professional morphological identification experts in primary medical units, and the samples of poisonous mushrooms are often incomplete after poisoning incidents, samples need to be extracted from leftovers, cooked mushrooms or vomit for identification, which is not conducive to the identification of poisonous mushrooms. Accuracy of identification of mushroom species hampers timely targeted treatment of poisoned patients

Images