Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

NK trophoblast cell and application thereof

A technology of trophoblast cells and NK cells, which is applied to NK trophoblast cells and its application fields, can solve the problems of inability to apply peripheral blood, small application range, and large cell differences, and achieve simple and efficient preparation methods, low technical requirements, The effect of low production cost

Pending Publication Date: 2021-04-30
HENAN HUALONG BIOLOGICAL TECH
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the great difference between cells in cord blood and peripheral blood, this method is only applicable to cord blood and cannot be applied to peripheral blood, and the application range is relatively small
[0004] At present, the culture of NK cells mainly includes trophoblast cell culture and pure factor cell culture, both of which have the problem of extremely high cost

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • NK trophoblast cell and application thereof
  • NK trophoblast cell and application thereof
  • NK trophoblast cell and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0081] In this example, recombinant vectors pUC57-CD19CD86, pUC57-IL-21-CD8α, pUC57-CD64 and pUC57-CD137L were constructed. The specific steps are as follows:

[0082] Four genes, CD19CD86, IL-21-CD8α, CD64 and CD137L, were synthesized and connected to the pUC57 vector through restriction sites, which were BamHI and EcoRI.

[0083] Wherein, CD19 and CD86 are connected through the connection sequence shown in SEQ ID No.11.

[0084] SEQ ID No. 11:

[0085]GGAAGCGGAGCTACCAACTTCTCCCCTGCTGAAGCAGGCCGGCGACGTGGAGGAGAACCCCGGCCCC.

[0086] The constructed recombinant vectors pUC57-CD19CD86, pUC57-IL-21-CD8α, pUC57-CD64 and pUC57-CD137L were verified by enzyme digestion. The enzyme digestion system is shown in Table 1.

[0087] Table 1

[0088] components Volume (μL) recombinant vector 5μg 10× buffer 2.5 0.1%BSA 5 BamHI 2.5 EcoRI 2.5 Ultra-pure water top up to 50 total capacity 50

[0089] The digestion conditions are: water...

Embodiment 2

[0094] This example uses the recombinant vector constructed in Example 1 to construct recombinant lentivirus Lent-CD19CD86, Lent-IL-21-CD8α, Lent-CD64, Lent-CD137L and control lentivirus Lent-EGFP. The specific steps are as follows:

[0095] (1) Extraction of recombinant plasmids:

[0096] a. Take out the preserved strains, streak the plate, culture at 37°C for 12 hours, pick a single clone, add it to 5mL culture medium, shake and culture it at 37°C for 6h, take 1mL bacterial liquid and add it to 100mL culture medium, Incubate with shaking at 37°C for 12 hours;

[0097] b. Take 30mL of bacterial liquid and add it to a 50mL centrifuge tube, centrifuge at 4900g for 10min at room temperature to collect the bacterial cells, repeat the operation until all the bacterial cells in the bacterial liquid are collected;

[0098] c. Add 10mL of Solution 1 (RNase A has been added) to resuspend the bacteria;

[0099] d. Add 10 mL of Solution 2, invert up and down 10 times, and incubate at ...

Embodiment 3

[0134] In this example, the recombinant lentivirus prepared in Example 2 was used to prepare trophoblast cells and detect them. The specific steps are as follows:

[0135] (1) Recombinant lentivirus infection of K562 cells:

[0136] Cultivate K562 cells, add virus solution and mix according to the ratio of MOI of 150:1, observe the cells, and change the medium or passage according to the state of the cells;

[0137] (2) Protein level detection:

[0138] The cells after virus infection were collected, and the expression of cell membrane proteins CD64, CD19, IL-21, CD86 and CD137L was detected by quality control flow cytometry, and the test results were as follows: Figure 1A , Figure 1B , Figure 1C , Figure 1D and Figure 1E shown.

[0139] It can be seen from the figure that the expression of CD64, CD19, IL-21, CD86 and CD137L can be detected in the recombinant K562 cells, in which the expression of CD64 is 67.93%, the expression of CD19 is 98.66%, and the expression o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an NK trophoblast cell and an application thereof, the NK trophoblast cell expresses a cytokine composition, and the cytokine composition comprises CD86, CD19, IL-21, CD137L and CD64; wherein the CD86 comprises an amino acid sequence as shown in SEQ ID No. 1. The invention also provides a recombinant vector, a recombinant lentivirus, a preparation method of the NK trophoblastic cell and an NK cell culture medium. The recombinant lentivirus is obtained by constructing the recombinant vector and packaging, and then introduced into the genome of the host cell, so that the prepared NK trophoblastic cell can continuously secrete the related protein for stimulating the proliferation and differentiation of the NK cell, the high-efficiency and low-cost amplification of the NK cell is realized, the preparation method is simple and efficient, and the application prospect is wide.

Description

technical field [0001] The invention belongs to the technical field of NK cell culture, and in particular relates to NK trophoblast cells and applications thereof. Background technique [0002] Natural killer cells (Natural killer cells, NK cells) are derived from bone marrow lymphoid stem cells and widely exist in lymphoid organs and peripheral tissues. 2%, there are also NK cells in the lymph nodes and bone marrow. NK cells are important immune cells for the body to defend against infection and prevent malignant transformation of cells, and participate in important physiological processes such as anti-tumor, anti-viral infection, and immune regulation. [0003] At present, the value of NK cells in tumor therapy has gradually been paid attention to, but the difficulty in obtaining NK cells limits its development in immunotherapy. CN107267454A discloses a method for in vitro expansion of umbilical cord blood NK cells and its kit and application. By activating and culturing...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N5/10C12N15/867C12N15/12C12N15/24C12N15/62C12N5/0783
CPCC12N5/0686C12N15/86C07K14/70503C07K14/70535C07K14/70532C07K14/70578C07K14/70517C07K14/54C12N5/0646C12N2510/00C12N2740/15043C12N2800/107C07K2319/00C12N2502/99C12N2501/51C12N2501/599C12N2501/2321C12N2501/505
Inventor 赵礼军熊建民
Owner HENAN HUALONG BIOLOGICAL TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com