Encoding gene related to grain shape of common wild rice and application thereof

An encoding gene, wild rice technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of small selection of excellent genes in rice and narrow range of gene sources.

Pending Publication Date: 2021-04-09
GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The main problem of high-quality rice breeding today is the narrow range of gene sources, resulting in a limited selection of good genes in rice

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Encoding gene related to grain shape of common wild rice and application thereof
  • Encoding gene related to grain shape of common wild rice and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055]Construction of general wild rice granulation related genes GL11-1 over-expression vector

[0056]1, GL11-1 genes

[0057]The DNA in ordinary wild rice Y12 (ORYZARUFIPOGON GRIFF.) Is used as a template, and PCR amplification is performed using the primer Primer1 and Primer2 to obtain a target gene:

[0058]PRIMER1: 5'ATGGTTGTCCCCCCTACGGTG 3 ';

[0059]Primer2: 5'ctaggacatacgtgtgct 3 '.

[0060]After recovering the PCR product, it is connected to ZERO to zero (purchased from Beijing full gold company) sequencing carrier, transforming DH5α sensitive cells, and sequencing after positive clones.

[0061]The sequencing results show that the amplified PCR product sequence such as the nucleotide sequence shown in SEQ ID NO.1, the length of 1730 bp, named GL11-1 gene, GL11-1 gene encoded protein amino acid sequence such as SEQ ID NO .2 shown.

[0062]2. Construction of a general wild rice granulation related gene GL11-1 over-expression vector (recombinant expression vector OE-GL11-1)

[0063]1) Amplifying wi...

Embodiment 2

[0067]Overgraduated GL11-1 transgenic plants and transgenic plants of transgenic plants in cultivating common wild rice type related gene GL11-1 expression levels

[0068]I. Cultivate the high-expression GL11-1 transgenic plants in the general wild rice type related gene GL11-1 increased, the recombinant vector OE-GL11-1 is mediated by the root cancer Agrobacterium Eha105 to mediate 253 japonica rice, specific methods as follows:

[0069]1, the recombinant carrier OE-GL11-1 obtained by Example 1 was introduced into a re-group root cancer Agrobacterium Eha105 containing recombinant carrier OE-GL11-1 with a thermosampled carrier EHA105; the recombinant carrier OE-GL11 was contained. The recombinant root cancer Agrobacterium EHA105 was incorporated at 28 ° C for 16 h, and the bacteria was collected; the bacteria was diluted with a N6 liquid medium containing a acetyl buttrazone in a concentration of 100 μm. , Diluted bacterial solution OD600≈0.5;

[0070]2, the cultured rice mature embryogenic ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an application of an encoding gene GL11-1 related to a grain shape of common wild rice in regulation and control of grain shape of rice. The encoding gene GL11-1 is derived from a DNA sequence of a Y12 strain of Oryzarufipogon Griff.; and the regulation and control of the rice grain shape refers to regulation and control of rice grain shape to be shortened and narrowed. The gene GL11-1 related to grain shape of common wild rice is identified for the first time, under conditions of enhanced function or increased expression of gene GL11-1, common wild rice with shorter and narrower grain shape can be obtained, and it is proved that common wild rice grain type related gene protein or the protein thereof plays an important role in controlling grain shape of common wild rice.

Description

Technical field[0001]The present invention relates to the field of genetic engineering, and in particular, to a coding gene associated with a common wild rice type and its application.Background technique[0002]Rice is one of the most important food crops of human beings. There are more than 100 countries in the world, and the population of 2 / 3 is as the main food in rice. Asia's demand increased year by year, due to the rapid economic development, the population pressure increased, the industrial land has increased, and the cultivated area is reduced, and rice production is facing huge pressure. Rice quality is closely related to granular shape, and its appearance is mainly measured by indicators such as granular, brothelation and transparency. Therefore, granular gene resources are provided to rice quality breeding, which is the main research direction of scientists.[0003]The main genetically active gene of regulating rice grows mainly comprises GS3, QGL3, GL4 and GLW7, which have ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/55C12N15/84A01H5/10A01H6/46
CPCC12N9/16C12N15/8261C12Y301/03003
Inventor 潘英华邓国富高利军戴高兴
Owner GUANGXI ZHUANG AUTONOMOUS REGION ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap