Encoding gene related to grain shape of common wild rice and application thereof
An encoding gene, wild rice technology, applied in the fields of application, genetic engineering, plant gene improvement, etc., can solve the problems of small selection of excellent genes in rice and narrow range of gene sources.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0055]Construction of general wild rice granulation related genes GL11-1 over-expression vector
[0056]1, GL11-1 genes
[0057]The DNA in ordinary wild rice Y12 (ORYZARUFIPOGON GRIFF.) Is used as a template, and PCR amplification is performed using the primer Primer1 and Primer2 to obtain a target gene:
[0058]PRIMER1: 5'ATGGTTGTCCCCCCTACGGTG 3 ';
[0059]Primer2: 5'ctaggacatacgtgtgct 3 '.
[0060]After recovering the PCR product, it is connected to ZERO to zero (purchased from Beijing full gold company) sequencing carrier, transforming DH5α sensitive cells, and sequencing after positive clones.
[0061]The sequencing results show that the amplified PCR product sequence such as the nucleotide sequence shown in SEQ ID NO.1, the length of 1730 bp, named GL11-1 gene, GL11-1 gene encoded protein amino acid sequence such as SEQ ID NO .2 shown.
[0062]2. Construction of a general wild rice granulation related gene GL11-1 over-expression vector (recombinant expression vector OE-GL11-1)
[0063]1) Amplifying wi...
Embodiment 2
[0067]Overgraduated GL11-1 transgenic plants and transgenic plants of transgenic plants in cultivating common wild rice type related gene GL11-1 expression levels
[0068]I. Cultivate the high-expression GL11-1 transgenic plants in the general wild rice type related gene GL11-1 increased, the recombinant vector OE-GL11-1 is mediated by the root cancer Agrobacterium Eha105 to mediate 253 japonica rice, specific methods as follows:
[0069]1, the recombinant carrier OE-GL11-1 obtained by Example 1 was introduced into a re-group root cancer Agrobacterium Eha105 containing recombinant carrier OE-GL11-1 with a thermosampled carrier EHA105; the recombinant carrier OE-GL11 was contained. The recombinant root cancer Agrobacterium EHA105 was incorporated at 28 ° C for 16 h, and the bacteria was collected; the bacteria was diluted with a N6 liquid medium containing a acetyl buttrazone in a concentration of 100 μm. , Diluted bacterial solution OD600≈0.5;
[0070]2, the cultured rice mature embryogenic ...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap