Plasmid and its constitution method and application in determining HIV carrying amount
An HIV and plasmid technology, applied in biological testing, measuring devices, introducing foreign genetic material using vectors, etc., can solve the problems of difficult clinical and scientific research, high technical requirements, and expensive detection kits, and achieves good specificity. , high sensitivity, simple operation effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0019] Below in conjunction with accompanying drawing, technical scheme of the present invention is described in further detail:
[0020] The plasmid is pSPgag737 / JM109 CGMCC NO.0486 containing the human HIV core antigen gene and using Escherichia coli JM109 as the carrier bacterium. The reason why this plasmid is identified as pSPgag737 is that HIV-1 gag gene fragment is inserted into its genome. Its taxonomic properties contain the SP6 RNA polymerase promoter and (dA:dT) 30 of plasmids. The relevant literature used as a judgment standard is GenBank / EMBL Accession Number: X65328.
[0021] 1. Construction of pSPgag737 plasmid
[0022] Using primers GAG1 (upstream, 5'GCAACCCTCTTAT TGTGTG3', 1043-1060) / GAG2 (downstream, 5'CCAACAAGGTTTCTGTCATC3', 1763-1744) to amplify the proviral DNA of 8E5 cells with the introduction of Sal I and Sac I restriction sites, respectively, After double digestion with Sal I and Sac I, the digested fragment was recovered and purified by low-meltin...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap