Application of ERK/mTOR signal path regulator to preparation of a drug for improving or treating neurodevelopmental disorder related diseases
A technology of signaling pathways and modulators, which can be used in neurological diseases, gene therapy, drug combinations, etc., and can solve problems affecting neuronal plasticity, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0033] The present invention will be described in further detail below in conjunction with the accompanying drawings and embodiments, without limiting the present invention.
[0034] 1. Carrier Construction
[0035] 1.1. Using the pEGFP-PLPPR4 vector retained in our laboratory as a template, PCR amplification was performed to obtain the PLPPR4 cDNA fragment, whose sequence number is shown in SEQ ID NO.5. It was electrophoresed on 1.2% agarose gel at 120V for 50 minutes, and then recovered by cutting the gel.
[0036] 1.2, T clone PCR amplification electrophoresis detection
[0037] After gel cutting and recovery of the amplified fragment, the T vector was connected overnight, the competent cell was transformed, and the agar plate containing Amp antibiotic was applied, and the positive monoclonal colony was obtained after culturing overnight. Its sequence is shown in SEQ ID NO.1: CGGGCCAAGTGGTTAAAAGC, and BGH universal primer, its sequence is shown in SEQ ID NO.2: TAGAAGGCACAG...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com