Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Polypeptide with binding affinity to chlamydia trachomatis MOMP and application of polypeptide

A Chlamydia trachomatis and affinity technology, applied in the field of biomedicine, can solve the problems of high cost, affecting the wide application of monoclonal antibodies, and large toxic and side effects

Active Publication Date: 2020-10-09
WENZHOU MEDICAL UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, mAb-based targeted therapy still has limitations in its application, such as poor tissue permeability, high toxicity and side effects, and high cost, which seriously affect the wide application of mAb in targeted therapy.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptide with binding affinity to chlamydia trachomatis MOMP and application of polypeptide
  • Polypeptide with binding affinity to chlamydia trachomatis MOMP and application of polypeptide
  • Polypeptide with binding affinity to chlamydia trachomatis MOMP and application of polypeptide

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0109] Example 1. Library Construction and Screening Research of Ct MOMP Binding Polypeptides

[0110] A random combinatorial library of phage-displayed Ct MOMP-binding polypeptides was constructed, that is, a library of many different SPA domain-related polypeptides, and Ct MOMP-binding polypeptides were screened from the library and their affinities were identified.

[0111] 1. Construction and identification of a random combinatorial phage display library of Ct MOMP-binding peptides

[0112] According to the amino acid sequence and structure of wild-type SPA-Z (Nilsson B et al., Protein Eng.1987; 1 (2): 107-113), random primers were designed for the coding sequences corresponding to its three helical regions, and amplified by PCR. A SPA coding sequence that can lead to random amino acid mutations was added and named SPA-N. According to the conventional method of molecular cloning, the SPA-N coding sequence was cloned into the pCANTAB5E vector through the SfiI and NotI site...

Embodiment 2

[0122] Example 2, Ct MOMP-binding polypeptide recombinant plasmid construction and prokaryotic protein expression and purification

[0123] 1 clone with a higher ELISA read was selected as before ( figure 1 Z in Ct MOMP), and Zwt as a negative control for Ct MOMP-binding polypeptides. In order to perform functional testing on the screened affibody molecules, construct recombinant plasmids, express and identify prokaryotic proteins, and prepare purified proteins.

[0124] 1. Construction and identification of recombinant plasmid of pET21a(+) / affibody

[0125] Design PCR primers and upstream primers with reference to the affibody gene sequence (GenBank: GY324633.1)

[0126] 5'GGGAATTC CATATG GTTGACAACAAATTCAACAAAGAA 3' (SEQ ID NO: 6, italics and underline indicate Ned I restriction site), downstream primer 5'CCG GAATTC CGTTTCGGAGCCTGAGCGT 3' (SEQ ID NO: 7, italics and underline indicate the XhoI restriction site); the correct sequencing of the screened tertiary library mo...

Embodiment 3

[0129] Example 3, Z Ct MOMP Binding to Ct MOMP protein

[0130] To identify Z Ct MOMP Binding specificity to Ct MOMP, using surface plasmon resonance (SPR) analysis of screened Z Ct MOMP The binding affinity and specificity of its control Zwt affibody to the target protein MOMP.

[0131] 1. Preparation and identification of Ct MOMP

[0132] The pET21a(+) / Ct MOMP constructed and stored in the laboratory was transformed into Escherichia coli BL21(DE3), and the recombinant protein was expressed after being induced by IPTG. The protein was purified by Ni-NTA affinity chromatography, and the Japanese white ear was routinely immunized Serum antibodies were prepared from rabbits. As a result, SDS-PAGE electrophoresis showed that an obvious protein band appeared at a relative molecular mass (Mr) of about 40kDa, which was consistent with the expected protein Mr size ( Figure 5 A); using the mouse anti-6×His mAb as the primary antibody for Western blot analysis, it can be seen tha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to a polypeptide specifically binding to a main outer membrane protein of chlamydia trachomatis and an application of the polypeptide. The polypeptide with binding affinity to the main outer membrane protein of chlamydia trachomatis is disclosed for the first time. The invention also provides an application of the polypeptide in diagnosis and detection, and a diagnosis or treatment application of the polypeptide as a targeting vector in drugs or molecular targeting reagents.

Description

technical field [0001] The invention relates to the field of biomedicine, more specifically, the invention relates to a polypeptide with binding affinity to the major outer membrane protein (MOMP) of Chlamydia trachomatis and its application. Background technique [0002] Chlamydia trachomatis (Ct) is one of the main pathogens of sexually transmitted diseases. It mainly causes urethritis in men and cervicitis in women, and is often mixed with other pathogens. It can infect women through sexual transmission and cause adverse pregnancy, such as miscarriage and stillbirth. , and is closely related to the occurrence of cervical cancer. In recent years, the incidence of STDs caused by Ct in my country has been on the rise, which has caused great harm to human health. For Ct infectious diseases, there is still no effective prevention and treatment method so far. As a kind of prokaryotic microorganisms with strict intracellular parasitism and unique developmental cycle, Ct exists...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K14/31C12N15/31A61K47/64A61P27/02A61P31/04A61P13/02G01N33/569
CPCA61K47/64A61P13/02A61P27/02A61P31/04C07K14/31G01N33/56927G01N2333/31
Inventor 朱珊丽张丽芳董海艳陈俊石威李文姝李明洋
Owner WENZHOU MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com