Plant constitutive promoter alspro and its application
A constitutive promoter and promoter technology, applied in the field of agricultural biology, can solve problems such as silencing of transgenes, and achieve the effects of reducing potential safety risks, being conducive to commercial applications, and having good market value and social benefits.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0063] The acquisition of embodiment 1 promoter ALSpro
[0064]The bioinformatic analysis of the upstream sequence of the gene encoding acetolactate synthase (ALS; EC2.2.1.6) through the activation function prediction software PlantCARE and PlantPAN found that the sequence is rich in a variety of promoter-related sequences. Functional elements such as CAAT-box, TATA-box, etc., indicating that the sequence has the structural characteristics of a plant cell promoter. And by PlantPAN analysis, its 1263-2180 sequence is rich in CpG islands, and CpG islands are also one of the sequence characteristics of eukaryotic promoters. It is speculated that this sequence may have promoter activity, and its core sequence is the 1263-2180 region.
[0065] The upstream sequences of the ALS gene of different lengths were intercepted to identify the promoter activity. After continuous screening and comparison, the sequence shown in SEQ ID NO.1 and SEQ ID NO.2 was finally determined as the promote...
Embodiment 2
[0072] Expression analysis of embodiment 2 promoter ALSpro
[0073] Use qPCR (fluorescence quantitative PCR) to identify the expression pattern of ALSpro downstream genes, the specific method is as follows:
[0074] The roots, leaves, young panicles, seedlings and calluses of ZH11 were taken respectively, total RNA was extracted, and cDNA was obtained by reverse transcription. In the Thermo PikoReal96 real-time fluorescent quantitative PCR system, Actin gene was used as an internal reference to detect the expression of ALS gene downstream of ALSpro.
[0075] qPCR primer sequences:
[0076] OsALSWT-qRtF2: GCACAATGAGTTGGACCAGCAG (SEQ ID NO. 11)
[0077] OsALSWT-qRtR2:GTCAGCTCATCCAGCACCTGAA (SEQ ID NO. 12)
[0078] Actin-F: AGCATGAAGATCAAGGTGGTC (SEQ ID NO. 13)
[0079] Actin-R: GCCTTGGCAATCCACATC (SEQ ID NO. 14)
[0080] The qPCR reaction system and procedure of ALS gene are as follows:
[0081] Program: Pre-denaturation at 94°C for 7 minutes, denaturation at 94°C for 15s,...
Embodiment 3
[0087] Embodiment 3 constructs the plant transgenic expression cassette and vector containing promoter ALSpro
[0088] 1. Preparation of a plant transgenic expression cassette containing promoter ALSpro (2180, SEQ ID NO.1)
[0089] The construction method of the plant transgenic expression cassette ALSpro2180-ALSm1-OsUbiT (sequence such as SEQ ID NO.7) of the present invention is as follows:
[0090] The primers 0310-AAU-F / 0310-AAU-Rv1 were designed to amplify the promoter OsALSP fragment from the rice genome; The ALSm1 fragment of the target gene was amplified; the terminator OsUbiT fragment was amplified from the rice genome using primers 0310-AAU-F3 / 0310-AAU-Rv. Among them, the 5' ends of primers 0310-AAU-F and 0310-AAU-Rv have about 15 nucleotide sequences repeated with the corresponding connection positions of the vector; the 5' ends of the upstream and downstream primers of adjacent fragments also have 15 bp repeats (0310- AAU-Rv1 and 0310-AAU-F2, 0310-AAU-Rv2 and 0310...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com