Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of NDUFA13 in preparation of spontaneous hepatitis-liver fibrosis animal model and preparation of drugs

A technology of liver fibrosis and animal models, which is applied in the fields of preparing drugs, diagnostic reagents and building animal models, and can solve problems such as unclear relationships

Pending Publication Date: 2020-04-17
CHILDRENS HOSPITAL OF CHONGQING MEDICAL UNIV
View PDF8 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although NDUFA13 is significantly absent in HCC, the relationship between NDUFA13 and precancerous pathological processes such as hepatitis, liver fibrosis, and cirrhosis is unclear

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of NDUFA13 in preparation of spontaneous hepatitis-liver fibrosis animal model and preparation of drugs
  • Application of NDUFA13 in preparation of spontaneous hepatitis-liver fibrosis animal model and preparation of drugs
  • Application of NDUFA13 in preparation of spontaneous hepatitis-liver fibrosis animal model and preparation of drugs

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0058] Example 1 Design and Construction of NDUFA13 Targeting Vector Plasmid

[0059] 1. Amplify mouse genome fragments from BAC clones with high-fidelity DNA polymerase and assemble them into targeting vectors together with recombination sites and selectable markers, such as figure 1 shown.

Embodiment 2

[0060] Example 2 transgene

[0061] 1. The targeting vector was electroporated into C57BL / 6ES cells, and 96 (one 96-well plate) G418-resistant clones were selected. The results of genetic recombination such as figure 2 shown. PCR screening strategies such as image 3 shown. PCR assay was performed using mNdufa_3'PCR_F / mNdufa_3'PCR_R and mNdufa_LoxP_F / mNdufa_LoxP_R primers. details as follows:

[0062] (1) 3'Arm PCR primer sequence

[0063] mNdufa_3'PCR_F:GCTGACCGCTTCCTCGTGCTTTA mNdufa_3'PCR_R:ACCATGCCTGGAATGAGACCCTAT The resulting fragment size was 3.7 kb.

[0064] (2) LoxP Site PCR primer sequence

[0065]

[0066] Such as Figure 4 As shown in A, there are 21 positive clones identified by 3'Arm PCR primers: 1A2, 1C2, 1F1, 1F2, 1G1, 1G2, 1H2, 1A3, 1B3, 1C3, 1D3, 1E4, 1G3, 1G4, 1H3, 1C5, 1C6 , 1F5, 1G5, 1H5 and 1H6. The above 21 positive clones were identified by LoxP Site PCR primers, such as Figure 4 As shown in B, there are 9 positive...

Embodiment 3

[0068] Example 3 NDUFA13 flox / - Cage Breeding and Identification of Alb-cre Mouse Strain

[0069] 1. NDUFA13 flox / - Alb-cre mouse breeding

[0070] (1) The above NDUFA13 flox / - Mice were co-caged with Alb-cre mice to obtain NDUFA13 flox / - Alb-cre mice.

[0071] 2. NDUFA13 flox / - Alb-cre mouse genotype identification

[0072] (1) After putting on sterile gloves, masks, caps, and sterile clothes, enter the SPF level animal laboratory. Use a sterilized instrument to mark the ear of the mouse, and take a 3-5mm mouse tail into a 1.5ml Ep tube with the corresponding number, add 200uL lysis buffer (10μm Tris-HCl pH8.0, 10μm EDTA, 15mM NaCl, 0.5% SDS) And 4uL proteinase k, 55 ℃ constant temperature digestion overnight. Centrifuge at 14000g for 10min, mix 100uL supernatant with an equal volume of isopropanol, vortex for 10-20s, centrifuge at 14000g for 15min, discard the supernatant, add 70% alcohol to wash the precipitate, vortex for 10-20s, centrifuge at 14000g for 10min, dis...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides NDUFA13 and application of a gene of NDUFA13 as a hepatitis or liver fibrosis drug or a diagnosis target. Research results show that the NDUFA13 and the gene thereof are closelyrelated to hepatitis or hepatic fibrosis; and a brand-new target and a novel diagnosis, prevention and treatment means and thought are provided for later research and development of hepatitis or hepatic fibrosis drugs and diagnostic reagents. Meanwhile, an NDUFA13 <flox / ->Alb-Cre mouse strain is constructed for the first time in the invention; the liver-specific NDUFA13 hybrid knockout mouse canstably generate non-infectious spontaneous liver inflammation that is developed into a liver fibrosis phenotype in the later period, so that a spontaneous hepatitis-liver fibrosis mouse model is formed and can be applied to liver inflammation-liver fibrosis mechanism research, new drug research and development evaluation and the like.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to the application of NDUFA13 in preparing medicines, diagnostic reagents and building animal models. Background technique [0002] Chronic liver disease is a general term for a spectrum of clinical chronic liver diseases, including various induced hepatitis, liver cirrhosis, and liver cancer. It has caused about 1.2 million deaths worldwide and seriously endangered human health. Many factors are related to the occurrence and development of chronic liver disease, such as viral infection, autoimmune reaction, allergic reaction, drug treatment, radiation, etc. These factors can induce the pathological trilogy process of "hepatitis-cirrhosis-liver cancer" in chronic liver disease, among which liver fibrosis (Liver fibrosis, LF), as a key stage in the progression of chronic liver disease, is a common pathological change in the progression of many chronic liver diseases to cirrhosis. Withou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85A01K67/027G01N33/68
CPCC12N15/85A01K67/0271G01N33/6893C12N2800/107A01K2227/105A01K2267/0368G01N2333/46Y02A50/30
Inventor 黄轶王欣薛炳乾叶庭菠李锐徐小惠黄道超曾欣
Owner CHILDRENS HOSPITAL OF CHONGQING MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com