LGI 1 gene mutation and application thereof in preparation of temporal lobe epilepsy co-disease depression animal model
An animal model, gene technology, used in applications, genetic engineering, DNA preparation, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0035] 1. Mouse model making
[0036] 1. Design, construction and purification of vectors
[0037] (1) In this strategy, mouse Lgi1-207 (ENSMUST00000198518.4) was selected for production, using the CRISPR Design tool of the Massachusetts Institute of Technology (http: / / crispr.mit.edu / ), and a 20bp target was designed according to the level of Score Target DNA, DNA sequence such as SEQ ID NO.1 (the underlined position is the mutation site a-g. At the same time, in order to prevent the cas9 protein from cutting the knock-in sequence on the Donor vector, construct the Donor vector mutation site and make a synonym on exon1 Mutation site, the double underlined position is mutated to a synonymous mutation made on exon1 (c-a, g-t) The oligonucleotide chain sequence of the sgRNA is used to prepare the sgRNA sequence (the sgRNA sequence is SEQ ID NO.2: CTGAGCCAACAGTGGTAGTA), and a Donor vector carrying the homology arm of the target site and the target knock-in sequence is designed...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap