Qtl-linked Molecular Markers for Wheat Effective Tiller Number and Its Application
A molecular marker and tiller number technology, which is applied in the fields of molecular biology and crop genetics and breeding, can solve the problem of insufficient molecular markers, and achieve the effects of accurate and efficient detection, convenient and stable amplification, and high success rate
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] Example 1 Acquisition of wheat effective tiller number QTL Qetn-1B.1 and its molecular marker KASP-1
[0041] (1) Using the wheat line '20828' as the female parent and the wheat variety 'SY95-71' as the male parent to cross, the hybrid F 1 , F 1 F 2 , at F 2 Using the single-ear transmission method, all the way to F 7 Generations, recombinant inbred lines containing 128 lines were obtained to form a genetic mapping population.
[0042] (2) Phenotypic identification of the effective tiller number of recombinant inbred lines: analyze and identify the effective tiller numbers of recombinant inbred lines at the maturity stage of wheat, remove the individual plants at both ends of each row, collect five individual plants with the same growth, and calculate the effective Tiller number, and get the average value, which represents the effective tiller number of the strain.
[0043] (3) 55K SNP chip analysis
[0044] a) DNA extraction: DNA of parent '20828', 'CN16' and rec...
Embodiment 2
[0052] Example 2 Application of Molecular Marker KASP-1 in Selection and Control of Effective Tiller Number QTL Qetn-1B.1
[0053] (1) Using the common wheat line 'S849-8' with few effective tillers as the female parent and the common wheat line 'SY95-71' with the large effective tillers as the male parent to construct a recombinant inbred line, and randomly select among the offspring lines 83 strains.
[0054] (2) Carry out KASP-1 marker detection on the obtained 83 strains, the specific method is: extract the DNA of 83 strains; use it as a template, and carry out PCR with the specific primer pair of molecular marker KASP-1 as primers To amplify and perform a fluorescent readout, the primers are:
[0055] Primers on the FAM tag: (the underlined part is the FAM tag sequence)
[0056] 5'- GAAGGTGACCAAGTTCATGCT TAATTCAGCAACTATTCCCCA-3' (SEQ ID No. 1)
[0057] Primers on the HEX tag: (the wavy part is the HEX tag sequence)
[0058] 5'- GAAGGTCGGAGTCAACGGATT TAATTCAGCAACTA...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com