Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer group for visual detection of MCR-3 polymyxin drug resistance gene, and detection method

A technology of MCR-3 and polymyxin, which is applied in biochemical equipment and methods, recombinant DNA technology, microbial measurement/inspection, etc., can solve the problems of expensive equipment, low efficiency, complicated detection procedures and methods, and achieve The effect of simple operation and great application value

Pending Publication Date: 2020-02-11
QINGDAO AGRI UNIV
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Due to the widespread existence of MCR-3, especially in healthy people and animal foods, the detection procedures and methods currently used for MCR detection, such as selective bacterial screening, mass spectrometry identification of bacterial species, drug sensitivity detection and ordinary PCR verification, have changed. cumbersome and inefficient
It has not been widely used clinically due to different reasons such as the need for expensive instruments and equipment.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer group for visual detection of MCR-3 polymyxin drug resistance gene, and detection method
  • Primer group for visual detection of MCR-3 polymyxin drug resistance gene, and detection method
  • Primer group for visual detection of MCR-3 polymyxin drug resistance gene, and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0034] In order to clearly illustrate the technical features of the solution, the solution will be described below through specific implementation modes.

[0035] A primer set and detection method for visually detecting MCR-3 polymyxin resistance gene, characterized in that the primer set includes outer primers F3 and B3, inner primers FIP and BIP;

[0036] The nucleotide sequences of each primer in the primer set are as follows:

[0037] Outer primer F3: CAACACCATCCGCTACAC;

[0038] Outer primer B3: TCCAGGTGACATCCACAC;

[0039] Internal primer FIP: AGCAACGCGGTGTTGTACTTGATTGGAGAGATGATTGCCA;

[0040] Internal primer BIP: CATGGTGAATCACTGGGAGCATTAAGGAACACGGGTCTGATC;

[0041] The internal primers and external primers were obtained by searching the mcr-3 gene sequence from the American gene database, and the homology analysis was carried out by BLAST software to obtain the specific conserved target sequence of the mcr-3 gene, and then according to the conserved target DNA sequen...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a primer group for visual detection of an MCR-3 polymyxin drug resistance gene, and a detection method, and belongs to the field of detection of bacterial drug resistance genes.According to the technical scheme, the primer group comprises an outer primer F3, an outer primer B3, an inner primer FIP and an inner primer BIP; an LAMP amplification reaction is carried out on a DNA sample at 62 DEG C, an appropriate amount of hydroxy naphthol blue (HNB) is added into an LAMP reaction system in advance, and whether the MCR-3 gene exists in a to-be-detected object or not is judged by observing the color change of reaction liquid. The primer group and the detection method have the beneficial effects that the MCR-3 gene can be quickly and efficiently detected with high specificity and high sensitivity under the condition of constant temperature, expensive and complex instruments are not needed, the new method is provided for detection of the bacterial drug resistance genes, and great application value is achieved.

Description

technical field [0001] The invention relates to the field of detection of bacterial drug-resistant genes, in particular to a primer set for visual detection of MCR-3 polymyxin drug-resistant genes and a detection method thereof. Background technique [0002] Since the 1920s, a large number of natural antibiotics have been discovered one after another, opening the era of antibiotics, but with the over-reliance on antibiotics, the problem of bacterial drug resistance has become increasingly prominent. Resistant bacteria make antibiotics less effective or even ineffective. Polymyxins (Polymyxins) is a group of polypeptide antibiotics extracted from the culture medium of Polymyxins, which has 5 components (A, B, C, D, E). Clinically commonly used are polymyxin (PolymyxinB) and polymyxin E (colislin, anti-enemy). Polymyxin is considered to be the last line of defense against bacteria; [0003] In recent years, the rapid evolution of the plasmid-mediated colistin resistance gen...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/689C12Q1/6844C12N15/11
CPCC12Q1/689C12Q1/6844C12Q2600/106
Inventor 郝智慧刘志海郭长梅黄亭亭
Owner QINGDAO AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products