Genetic engineering strain for accumulating emodin and construction method and application thereof
A technology for genetically engineered strains and emodin, applied in the field of genetic engineering, can solve problems such as inability to synthesize, a small amount of synthetic related products, and a complex biosynthetic mechanism.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0062] Example 1, Construction of Aspergillus terreus efficient gene targeting platform
[0063] Aspergillus terreus ATCC20542 is a strain for studying secondary metabolites. This example refers to Example 2 of the invention patent "A Method and Application of Improving the Application Efficiency of Gene Targeting Technology in Aspergillus terreus, ZL201510275491.5" to knock out soil Aspergillus ATCC20542's ku80 constructed a highly efficient gene targeting Aspergillus ATCC20542-Δku80 (ATCC20542, Δku80::ptrA), and further referred to Example 5 of the patent application to knock out the pyrG gene to construct a genetic transformation based on uracil auxotrophy The screened chassis cell strain Aspergillus ATCC20542-ΔpyrG (ATCC20542, Δku80::ptrA, ΔpyrG), except that the host bacteria was replaced by Aspergillus terreus ATCC20542, the above operation is exactly the same as the steps in the example of patent ZL201510275491.5.
Embodiment 2
[0064] Example 2. Activation of the emodin biosynthetic pathway by regulatory factor overexpression in Aspergillus terreus ATCC20542
[0065] 1) Construction of transcriptional regulators to activate DNA elements
[0066] Design and synthesize the following primers:
[0067] Uku80-F: 5'-agcacaaacatattgatcagc-3';
[0068] pyrGAn-R:5'-ggatcctcccagagtgtaagcatcaaatcgtcgtaccgca-3';
[0069] trpC-F3:5'-aagcttgagatccacttaacgttactgaaatcatc-3';
[0070] Dku80-R:5'-gaaggcgaaaagtagtctcgtg-3';
[0071] PgpdAt-F743:5'-ttacactctgggaggatccaggtac-3';
[0072] PgpdAt-R1:5'-tgtgatgattgatgagttgttg-3'.
[0073] In order to amplify the DNA sequences of the transcriptional regulators ATEG_08438, ATEG_08442, ATEG_08452 and ATEG_08453, the primers were designed as follows:
[0074] 08438-F: ACAACTCATCATCAATCATCAC ATGTCTGTCCAGAAACGCGCAC,
[0075] 08438-R: GTTAAGTGGATCTCAAGCTT CACAGACTGGCTGGTCTTGGG;
[0076] 08442-F: ACAACTCATCATCAATCATCAC ATGTTCATCACACTGAAATGTC,
[0077] 08442-R: GTTA...
Embodiment 3
[0090] Embodiment 3, the analysis of engineering strain fermentation production emodin and emodin derivatives
[0091] The engineered strain ATCC20542- OE 08438, ATCC20542- OE 08442 ATCC20542- OE 08452, ATCC20542- OE 08453 and the control strain ATCC20542-Δku80 were respectively inoculated on PDA solid plates, and cultured at 30°C for 7 days to obtain spores. The spores were respectively inoculated into 35 ml of SMP seed medium (250 mL Erlenmeyer flask), and cultured with shaking at 28° C. and 220 rpm for 48 hours. Inoculate 3.5 mL of seed liquid into 50 mL of SMP fermentation medium (250 mL Erlenmeyer flask) respectively, and culture at 28°C and 220 rpm for 8 days with shaking to obtain the fermentation liquid of each strain.
[0092]Analysis and comparison of fermented crude extracts. After fermentation, 200-mesh nylon cloth was used to separate the bacterial cells from the bacterial liquid. The bacterial cells were soaked in dichloromethane and methanol (V / V=1:1) and ul...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com