Ovine babesia universal detection kit
A general-purpose detection technology for Babesia sheep, applied in the field of general-purpose kits for the detection of Babesia sheep antibodies, can solve the problems of only specific detection, low efficiency, cumbersome operation, etc., and achieve easy standardization, simple operation, cost saving effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0021] The present invention is illustrated below in conjunction with examples.
[0022] 1. Obtaining the target protein
[0023] 1. Acquisition of the target gene (two artificial sequences)
[0024] SEQ ID No. 1: Bsp-AMA1-F
[0025] 5' CCGGAATTCAGGTTTGACATTCCTAGGGT 3'
[0026] SEQ ID No. 2: Bsp-AMA1-R
[0027] 5' ATTTGCGGCCGC GTACTTAGTTAGCTTGTCTG 3', the pre-obtained target fragment size is 393bp (bases 288-681 of the AMA1 nucleotide sequence)
[0028] 2. Construction of recombinant expression vector
[0029] Using the cDNA of the unspecified Xinjiang strain of Babesia ovis preserved in the laboratory as a template for amplification, a 50 μL PCR reaction system was used. The reaction conditions were pre-denaturation at 94°C for 3 minutes, followed by 1 minute at 94°C, 1 minute at 56°C, and 30 seconds at 72°C. 34 cycles, 72°C extension for 10 min. PCR amplification products were identified by agarose gel electrophoresis. PCR products identified as positive were purified a...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com