Preparation method, purification method and applications of PEG-modified recombinant humanized urate oxidase
A technology of urate oxidase and urate oxidase protein, which is applied in the field of protein engineering and can solve problems such as sensitivity, loss of enzyme activity, and intolerance
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0076] Construction of humanized urate oxidase high-expression strain
[0077] The sequence (SEQ ID NO :3), after adding NcoI (CCATGG) and XhoI (CTCGAG) double restriction sites at the front and rear ends of SEQ ID NO: 3, artificially synthesized SEQ ID NO: 4 (for Suzhou Jinweizhi Biotechnology Co., Ltd.), after synthesis The sequence of SEQ ID NO: 4 was double digested (NcoI and XhoI) and connected to the same double digested pET-28a vector, and then transformed into DH5α cells to amplify and extract the plasmid to obtain an expression vector.
[0078] SEQ ID NO:4
[0079]CCATGGATTATAAGAAAAATGATGAAGTGGAGTTTGTGCGCACCGGCTATGGCAAGGAAATGGTGAAGGTGCTGCACATCCAGCGTGATGGCAAATATCATAGCATTAAAGAAGTGGCCACCAGCGTGCAGCTGACCCTGAGCAGCAAAAAGGATTACCTGCACGGCGACAACAGCGATATCATTCCGACCGACACCATCAAGAATACCGTGCATGTGCTGGCCAAATTCAAGGGCATCAAGAGCATCGAGGCCTTCGCCATGAATATCTGCGAGCATTTTCTGAGCAGCTTCAACCACGTGATTCGTGCCCAGGTGTATGTGGAAGAAGTGCCGTGGAAGCGCTTCGAGAAAAATGGCGTGAAGCACGTGCATGCCTTTATCCATACCCCGACCGGCACCCACTTTTGC...
Embodiment 2
[0082] Expression and purification of humanized urate oxidase
[0083] Step (1). Protein expression:
[0084] a) Recovery of the target strain: take out the target bacteria frozen in glycerol from -80°C, dilute 100,000-fold with LB in a clean bench, spread it on an LB plate with 50 μg of Kanamycin, place it upside down in a 37°C incubator, and cultivate overnight Store in a refrigerator at 4°C and recover after 2 months.
[0085] b) Seed culture: Prepare 70ml of 50μg Kanamycin LB sterile medium in a 200ml triangular medicine bottle, pick a single colony on the plate and place it in the medium, and culture it overnight in a shaker at 37°C and 180rpm.
[0086] c) Batch culture and induced expression: Prepare 400ml of 50μg Kanamycin LB sterile medium in a 1L Erlenmeyer shaker flask, add 4ml of seed solution to the 400ml medium in an ultra-clean workbench (shake well before absorbing), seal and place in Cultivate in a shaker at 37°C and 250 rpm. Waiting for OD 600 At 0.6-0.8 (...
Embodiment 3
[0106] Step (4) Add 10% sucrose to the buffer solution, then add CH 3 COOH reduces the pH of the buffer to 8.5, and the rest of the steps are exactly the same as in Example 2.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com