Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

Cotton verticillium wilt resistance related gene ghabc and its encoded protein and application

A cotton verticillium wilt and gene technology, applied in the field of agricultural biology, can solve the problems of cotton yield harm and the like

Active Publication Date: 2022-04-08
INST OF COTTON RES CHINESE ACAD OF AGRI SCI
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0002] Cotton is an important textile raw material and an important economic crop. However, as a worldwide disease, cotton verticillium wilt has caused great harm to cotton production. As a soil-borne vascular disease, the disease has no ideal The prevention and control measures of the disease-resistant varieties through genetic engineering have become an important technical means to solve the cotton verticillium wilt

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cotton verticillium wilt resistance related gene ghabc and its encoded protein and application
  • Cotton verticillium wilt resistance related gene ghabc and its encoded protein and application
  • Cotton verticillium wilt resistance related gene ghabc and its encoded protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Embodiment 1 obtains cotton gene GhABC

[0028] Zhimian 2, a disease-resistant variety, and Jimian 11, a susceptible variety, were used as plant materials. After inoculating the cotton Verticillium wilt pathogen Vd080, the whole cotton protein was extracted, and the cotton not inoculated with the pathogen was used as the blank control. Enzymatic hydrolysis of the extracted whole protein with trypsin, using metal oxide TiO 2 The affinity for phosphate groups enables the enrichment of phosphorylated peptides containing serine (S), threonine (T), and tyrosine (Y), and the use of groups with high affinity for acetylated lysine Sequence antibody, which specifically enriches acetylated peptides in complex samples, uses motif antibodies with high affinity for ubiquitinated lysine, specifically enriches ubiquitinated peptides in complex samples, and differently modified The enrichment is subjected to liquid mass spectrometry (LC-MS / MS) protein quantitative method to realize qu...

Embodiment 2

[0030] The expression of GhABC in cotton after the treatment of embodiment 2 pathogenic bacteria and hormone

[0031] The resistant cotton variety Zhongzhimian 2 and the susceptible variety Jimian 11 were planted in vermiculite sandy soil paper pots as experimental materials.

[0032] Vd080 spore suspension was inoculated after root injury, and root RNA was extracted at 12h, 24h, 48h and 72h, respectively.

[0033] with 0.5mM hydrogen peroxide (H 2 o 2 ), 0.1mM salicylic acid (SA), 0.15mM methyl jasmonate (JA) and 1mM ethylene (ET) were sprayed until the leaves dripped, and root RNA was extracted at 12h, 24h, 48h and 72h, respectively.

[0034] The fluorescent quantitative primers were designed as: GhABC-F:TTCAGCCTGTTGGTCGTG, GhABC-R:GCGGGATTATTATGTCCTTG. The expression of GhABC was detected after pathogenic bacteria and hormone treatment.

[0035] like figure 1 It was shown that the expression of GhABC in susceptible and resistant varieties was inhibited at the initial s...

Embodiment 3

[0037] Example 3. The use of virus-mediated gene silencing technology (VIGS) to study the function of GhABC

[0038] 1. Silencing the gene GhABC in cotton

[0039] Design of primers for GhABC silencing vector

[0040] ABC-VIGS-F:GCTCTAGATCAGAAACACCGTGGACA,

[0041] ABC-VIGS-R: GGGGTACCTTAACTCATTTACTAACGCCTT.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of agricultural biotechnology, and in particular relates to the cotton Verticillium wilt resistance related gene GhABC and its encoded protein and application. The nucleotide sequence of the cotton verticillium wilt resistance-related gene GhABC of the present invention is shown in SEQ ID No.2, and the amino acid sequence of its encoded protein is shown in SEQ ID No.1. After the gene silencing plants are inoculated with the spore suspension of the cotton Verticillium dahliae pathogen Vd080, the silencing plants are more susceptible to the disease. Through mechanism research, it is found that the synthesis of xylem and callose in the silencing plants decreases, the ROS decreases, and the expression of some defense genes is down-regulated. It proved that GhABC is positively correlated with cotton resistance to Verticillium wilt, and GhABC can be used as a candidate gene for cotton breeding for disease resistance.

Description

technical field [0001] The invention belongs to the field of agricultural biotechnology, and in particular relates to the cotton Verticillium wilt resistance related gene GhABC and its encoded protein and application. Background technique [0002] Cotton is an important textile raw material and an important economic crop. However, cotton verticillium wilt, as a worldwide disease, has caused great harm to cotton production. As a soil-borne vascular disease, the disease has no ideal The prevention and control measures of cotton and the selection of disease-resistant varieties through genetic engineering have become an important technical means to solve cotton verticillium wilt. Contents of the invention [0003] The object of the present invention is to provide a cotton Verticillium wilt resistance phase gene GhABC. [0004] Another object of the present invention is to provide the encoded protein of the above gene. [0005] Another object of the present invention is to pr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C07K14/415C12N15/29C12N15/82C12N1/21A01H5/00A01H6/60
Inventor 冯鸿杰周京龙朱荷琴冯自力魏锋师勇强赵丽红袁媛
Owner INST OF COTTON RES CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com