Cotton verticillium wilt resistance related gene ghabc and its encoded protein and application
A cotton verticillium wilt and gene technology, applied in the field of agricultural biology, can solve the problems of cotton yield harm and the like
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0027] Embodiment 1 obtains cotton gene GhABC
[0028] Zhimian 2, a disease-resistant variety, and Jimian 11, a susceptible variety, were used as plant materials. After inoculating the cotton Verticillium wilt pathogen Vd080, the whole cotton protein was extracted, and the cotton not inoculated with the pathogen was used as the blank control. Enzymatic hydrolysis of the extracted whole protein with trypsin, using metal oxide TiO 2 The affinity for phosphate groups enables the enrichment of phosphorylated peptides containing serine (S), threonine (T), and tyrosine (Y), and the use of groups with high affinity for acetylated lysine Sequence antibody, which specifically enriches acetylated peptides in complex samples, uses motif antibodies with high affinity for ubiquitinated lysine, specifically enriches ubiquitinated peptides in complex samples, and differently modified The enrichment is subjected to liquid mass spectrometry (LC-MS / MS) protein quantitative method to realize qu...
Embodiment 2
[0030] The expression of GhABC in cotton after the treatment of embodiment 2 pathogenic bacteria and hormone
[0031] The resistant cotton variety Zhongzhimian 2 and the susceptible variety Jimian 11 were planted in vermiculite sandy soil paper pots as experimental materials.
[0032] Vd080 spore suspension was inoculated after root injury, and root RNA was extracted at 12h, 24h, 48h and 72h, respectively.
[0033] with 0.5mM hydrogen peroxide (H 2 o 2 ), 0.1mM salicylic acid (SA), 0.15mM methyl jasmonate (JA) and 1mM ethylene (ET) were sprayed until the leaves dripped, and root RNA was extracted at 12h, 24h, 48h and 72h, respectively.
[0034] The fluorescent quantitative primers were designed as: GhABC-F:TTCAGCCTGTTGGTCGTG, GhABC-R:GCGGGATTATTATGTCCTTG. The expression of GhABC was detected after pathogenic bacteria and hormone treatment.
[0035] like figure 1 It was shown that the expression of GhABC in susceptible and resistant varieties was inhibited at the initial s...
Embodiment 3
[0037] Example 3. The use of virus-mediated gene silencing technology (VIGS) to study the function of GhABC
[0038] 1. Silencing the gene GhABC in cotton
[0039] Design of primers for GhABC silencing vector
[0040] ABC-VIGS-F:GCTCTAGATCAGAAACACCGTGGACA,
[0041] ABC-VIGS-R: GGGGTACCTTAACTCATTTACTAACGCCTT.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com