Supercharge Your Innovation With Domain-Expert AI Agents!

Female acipenser schrenckii special DNA fragment and application

A sturgeon, fragment technology, applied in DNA/RNA fragment, recombinant DNA technology, microbial determination/inspection, etc., can solve the problem of not identifying gender-specific markers, etc.

Active Publication Date: 2019-04-02
YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
View PDF5 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, when the sex chromosomes are in the early stage of differentiation or the non-recombination regions of the sex chromosomes are very rare, sex-specific markers may not be identified by RAD sequencing technology, because the restriction endonucleases are selective enzymes for the genome.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Female acipenser schrenckii special DNA fragment and application
  • Female acipenser schrenckii special DNA fragment and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Obtaining the specific DNA fragments of female Sturgeon's sturgeon:

[0023] 1. Low-coverage whole-genome sequencing scans the individual genomes of male and female stylized sturgeons: 20 male and female stylized sturgeons are identified by paraffin sections of gonad tissue, and their whole-genome DNA is extracted. Genomic DNA is randomly interrupted by ultrasonic waves, sequencing library preparation, and library quality Detection and sequencing on the Illumina sequencing platform to obtain the raw data of whole genome sequencing of male and female Sturgeon's sturgeon, and perform quality control on the raw data to obtain valid data;

[0024] 2. Use the K-mer method to analyze the genome data of the male and female groups to obtain candidate sex-specific fragments: First, cut the effective data of each individual into K-mers with a length of 21bp, and obtain 40 K-mer data with a length of 21bp Set, screen out female-specific K-mers that are not available in males as fe...

Embodiment 2

[0027] The detection method of the specific DNA fragment of the female Sturgeon's sturgeon:

[0028] The primers designed for ACSC-FS01 (SEQ ID NO.1) are:

[0029] ACSC-FS01F(5′-3′):ATAACATAGTTCATTAATAATGCCT

[0030] ACSC-FS01R(5'-3'):CGCCAACAGTGAATACGTT;

[0031] The corresponding PCR amplification conditions are:

[0032] Pre-denaturation at 95°C for 5min; followed by denaturation at 95°C for 30s, annealing at 56°C for 30s, extension at 72°C for 20s, amplification for 35 cycles, and extension at 72°C for 7min.

[0033] The primers designed for ACSC-FS02 (SEQ ID NO.2) are:

[0034] ACSC-FS02F(5′-3′):GGCCATAACTGTACATATAGAAC

[0035] ACSC-FS02R(5′-3′):CTTTCGATTATGCCGGACA

[0036] The corresponding PCR amplification conditions are:

[0037] Pre-denaturation at 95°C for 5min; followed by denaturation at 95°C for 30s, annealing at 54°C for 30s, extension at 72°C for 20s, amplification for 35 cycles, and extension at 72°C for 7min.

Embodiment 3

[0039] The application of the specific DNA fragment of female Stryckey's sturgeon or the primers designed for it in identifying the sex of Stryckey's sturgeon:

[0040] Firstly, the genome DNA of 24 fin rays of male and female Stryker's sturgeon was extracted by the high-salt method, and the integrity and concentration of the extracted DNA were detected by agarose electrophoresis and spectrophotometer;

[0041] The above-mentioned DNA was amplified by conventional PCR using the primers involved in Example 2. The amplification system was: about 10 ng of template DNA; 1.5 U of Taq polymerase; 2.5 μl of 10× amplification buffer; the concentrations of the four dNTPs were 200 μM respectively; The final concentration of the upstream and downstream primers is 0.2 μM; add ddH 2 0 to 25 μl.

[0042] Amplification results such as figure 1 and figure 2 Shown:

[0043] Regardless of the primers designed for SEQ ID NO.1 or the primers designed for SEQ ID NO.2, specific bands can be am...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical fields of an acipenser schrenckii molecular marker and heredity sex determination, and particularly relates to a female acipenser schrenckii special DNA fragmentand an application. Through screening, the female acipenser schrenckii special DNA fragment is obtained, and the fragment is shown as SEQID NO.1 or SEQID NO.2. The obtained female acipenser schrenckii special fragment design primer is subjected to regular-PCR verification in acipenser schrenckii samples, and then, an effective primer pair namely an acipenser schrenckii group is verified and applied. The method provides a way for screening species sex specificity fragments and is particularly used for complex genome species; and besides, the difficult problem of sex determination of the acipenser schrenckii is solved.

Description

technical field [0001] The invention belongs to the technical field of molecular markers and genetic sex identification of Stryckey's sturgeon, and more specifically relates to a specific DNA segment of female Strykyu's sturgeon and its application. Background technique [0002] Acipenser schrenckii (Acipenser schrenckii) is a rare and valuable large economic fish endemic to the Heilongjiang water system in my country. Sturgeon's sturgeon has the advantages of fast growth, disease resistance and strong adaptability, and has become one of the important objects of breeding in recent years. The caviar made from the roe of Sturgeon's sturgeon is rich in essential amino acids, multiple unsaturated fatty acids, vitamins and other substances. It has high nutritional value and enjoys the reputation of "black gold". In terms of breeding, sex screening can be carried out in the early stage, and directional selection can be carried out on the female and male groups, which can obtain h...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6888C12Q1/6879C12N15/11
CPCC12Q1/6879C12Q1/6888
Inventor 阮瑞冯彤李创举危起伟岳华梅叶欢杜浩刘志刚阮珏
Owner YANGTZE RIVER FISHERIES RES INST CHINESE ACAD OF FISHERY SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More