Y2SK2 dehydrin reducing cell stress damage and improving ultralow temperature storage effect
A technology of cryopreservation and dehydrin protein, applied in the field of preservation of plant materials, can solve problems such as no development and application, achieve large application and promotion value, improve recovery growth rate, and optimize cryopreservation effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0051] Embodiment 1, dehydrin protein ApY 2 SK 2 Prokaryotic expression and enrichment purification
[0052] 1. Obtain the coded dehydrin protein ApY 2 SK 2 ORF sequence.
[0053] Using Agapanthus cDNA as a template, ApY with a full length of 561bp was obtained by RACE (rapid-amplification of cDNA ends) gene full-length cloning method 2 SK 2 Gene ORF region sequence (SEQ ID NO.1), encoding ApY 2 SK 2 protein.
[0054] 2. Construction of prokaryotic expression vector
[0055] 1) According to ApY 2 SK 2 For the ORF sequence of the gene and the multiple cloning site in the plasmid, EcoRI and XholⅠ restriction sites were selected, and the primer pET-YSK-S / A was designed using Primer 5.0 software, and the target fragment was amplified by PCR and the restriction site was introduced.
[0056] pET-YSK-S (SEQ ID NO.2): TCGAATTCATGGACATGAGGGATCAGT
[0057] pET-YSK-A (SEQ ID NO.3):AAACTCGAGCTGATGGGAGCCAGG
[0058] 2) For the pET21a plasmid and the ApY after introducing the ...
Embodiment 2
[0062] Embodiment 2, add protein ApY 2 SK 2 , optimize the vitrification cryopreservation system
[0063] 1) Seedling cultivation of Arabidopsis thaliana: Seeds of wild-type Arabidopsis (Col-0) were sterilized and sown on MS solid medium, and seedlings were cultivated for 60 h. Specifically: Arabidopsis thaliana (Col-0) seeds were sterilized with 70% ethanol and 2% sodium hypochlorite, sown on MS solid medium, and after being purified at 4°C for 48 hours, they were transferred to a light incubator with a photoperiod of 8 hours and light exposure. The intensity is 150 μmol m- 2 ·s- 1 , day and night temperature are 25 ℃ and 20 ℃, humidity 60% to 80%. Seedlings germinated for 60 hours were taken as samples for cryopreservation by vitrification method.
[0064] 2) Loading liquid treatment: 60h seedlings of Arabidopsis were transferred to the loading liquid and soaked at room temperature for 20 min;
[0065] 3) Vitrification solution treatment: the seedlings were transfer...
Embodiment 3
[0074] Example 3, verification of dehydrin protein ApY 2 SK 2 Protects against oxidative stress
[0075] 1) Add 0.2mL 0.2mM FeSO 4 Mix with 0.2mL 1mM bromopyrogallol, then add 0.2mL 0.5% H 2 o 2 solution and BSA, ApY 2 SK 2 protein solution.
[0076] 2) Add 0.2mL 0.5% H to the experimental group 2 o 2 and BSA solution, ApY 2 SK 2 Protein solution, the concentration is 0.02, 0.05 and 0.1mg / mL; negative control group added 0.2mL 0.5% H 2 o 2 , no protein solution was added; the blank group did not add H 2 o 2 and protein solution.
[0077] 3) Measure the absorbance value of the sample at a wavelength of 550 nm. The absorbance value of the experimental group was As, and the absorbance value of the negative control group was A C , the absorbance value of the blank group is A 0 .
[0078] 4) Calculate the BSA and ApY of the experimental group 2 SK 2 Relative inhibition rate of protein solution to hydroxyl radical (OH·) generation.
[0079]
[0080] The re...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com