Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit used for detecting swine salmonella antibody

A kit, Salmonella technology, applied in the direction of measuring devices, instruments, scientific instruments, etc., to achieve the effect of easy operation, good repeatability, and reduce the rate of missed detection

Active Publication Date: 2019-03-05
CHINA AGRI UNIV
View PDF4 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There is currently no report on the detection of Salmonella using the fljB antigen

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit used for detecting swine salmonella antibody
  • Kit used for detecting swine salmonella antibody
  • Kit used for detecting swine salmonella antibody

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Example 1 Construction of pET-32a-fljB prokaryotic expression plasmid

[0045] Primer design and synthesis, designed primers to amplify the fljB gene, for the same conserved region of the same target gene, the inventor designed multiple pairs of primers:

[0046] F0 F: CGCGGATCCATGGCACAAGTAATCAACACTAACAG (SEQ ID NO. 5)

[0047] F0 R: CCGCTCGAGTTAACGTAACAGAGACAGCACGTT (SEQ ID NO. 6)

[0048] F1 F: CGCGGATCCATGGCACAAGTAATCAACACTAACAGT (SEQ ID NO. 1)

[0049] F1 R: CCGCTCGAGTTAACGTAACAGAGACAGC (SEQ ID NO. 2)

[0050] F2 F: CGCGGATCCATGGCACAAGTAATCAACAC (SEQ ID NO. 7)

[0051] F2 R: CCGCTCGAGTTAACGTAACAGAGACAGC (SEQ ID NO. 8)

[0052] From the electropherogram of the amplified product, see figure 1 , the F2 primer was not amplified, although both F0 and F1 were amplified, but after sequencing, it was found that there were many mutations in F0, such as figure 2 , and finally the inventors selected all correct F1 primers for sequencing as amplification primers.

[005...

Embodiment 2

[0060] Example 2 Prokaryotic expression and purification of recombinant protein

[0061] 1. For the colony pET-32a-fljB with the correct sequence in Example 1, pick a single colony and inoculate it in liquid LB medium containing Amp+, shake overnight at 37°C. Take the overnight culture and inoculate it in the liquid LB medium containing Amp+ in an amount of 2%, shake it at 37°C until the A600 value is 0.5-1.0, add IPTG to the final concentration of 1mM, shake it at 30°C and 37°C respectively, and At different times of culture (0, 3, 6, 10 h), take 1 mL of the bacterial solution from the culture and transfer it to a centrifuge tube, centrifuge at 10,000 r / min for 5 min, collect the bacterial pellet, resuspend the pellet and ultrasonically break it, and then 4000 r / min Min and then centrifuged for 10 min, respectively take 10 μL of supernatant and precipitate, add 90 μL 2×loading buffer and 10 μL 1mol / L DTT to suspend and mix, boil for 5 min, and perform SDS-PAGE electrophoresis...

Embodiment 3

[0065] The establishment of embodiment 3 ELISA and condition optimization

[0066] 1. Reagents for ELISA detection

[0067] (1) Coating solution: 0.05mol / L carbonate buffer solution, stored at 4°C.

[0068] (2) Sample diluent: phosphate-Tween buffer containing 1% bovine serum albumin (BSA).

[0069] (3) Blocking solution: phosphate-Tween buffer containing 5% bovine serum albumin (BSA).

[0070] (4) Enzyme-labeled secondary antibody: goat anti-pig IgG / HRP.

[0071] (5) Substrate buffer (phosphate-citrate buffer (PBS, pH5.0): 0.2mol Na 2 HPO 4 12H 2 O25.7mL, 0.1mol citric acid 24.3mL, deionized water 50mL.

[0072] (6) TMB substrate chromogenic solution: 0.01g TMB dry powder was dissolved in 1mL DMSO, and 9.9mL substrate buffer was added to 30μL H 2 o 2 , and then add 100 μL of TMB dissolved in DMSO.

[0073] (7) stop solution (2M H 2 SO 4 ): distilled water 178.3mL, add concentrated 2M H 2 SO 4 21.7mL.

[0074] (8) 0.05% PBST: Add 0.5 mL of Tween-20 to 1 L of PBS...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Dilution degreeaaaaaaaaaa
Login to View More

Abstract

The invention provides a kit used for detecting swine salmonella antibody. The kit comprises antigen protein; the antigen protein is fljB protein, and the amino acid sequence of the antigen protein isrepresented by SEQ ID NO.3. The fljB protein is excellent in antigenicity, and high in specificity, purity, and yield; in the kit, the antigen protein coating concentration is 20<mu>g / ml, and negative and positive serum dilution ratio is 1:200. The kit can be used for swine salmonella fljB antibody rapid detection of clinical samples, is capable of solving a problem in the prior art that there isno single antigen salmonella infection diagnosis method, reducing failure detection rate, and increasing precision. A sensitive detection method is provided for swine salmonella epidemiological investigation in China, and the kit can be used for early diagnosis of swine salmonella infection.

Description

technical field [0001] The invention relates to an ELISA detection kit, in particular to a detection kit for swine Salmonella antibody. Background technique [0002] Salmonella (Salmonella) is a Gram-negative bacterium that widely exists in nature and relies on flagellar movement. It does not produce spores, and some contain capsules. It belongs to the Enterobacteriaceae Salmonella genus. It can be found in the intestines of all kinds of animals. Salmonella is one of the leading causes of foodborne illness and can be spread through livestock feces, polluted water, fertilization techniques, etc., and it can grow in many different foods, making it a serious disease for humans and An important control object for animals. So far, more than 67 kinds of Salmonella O antigens and more than 2,000 serotypes have been discovered, and new serotypes are discovered almost every year, which brings great difficulties to the serological diagnosis and detection of Salmonella infection. Ti...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/558G01N33/569G01N33/535
CPCG01N33/535G01N33/558G01N33/56916
Inventor 王九峰焦连国才冬杰朱要宏邵艳艳
Owner CHINA AGRI UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com