Oyster CRISPR/Cas9 gene editing method
A gene editing, oyster technology, applied in genetic engineering, biochemical equipment and methods, other methods of inserting foreign genetic material, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0022] Taking the long oyster SET and MYND domain containing 5 (SMYD5) gene as an example, the oyster gene editing technology was established, which will be further elaborated below.
[0023] 1) Obtaining fertilized eggs of long oyster
[0024] The oyster broodstock with mature gonads was selected, and the fertilized eggs were collected by dissection, artificially inseminated, and the fertilized eggs obtained were used for gene editing.
[0025] 2) Construction of the sgRNA of the long oyster target gene SMYD5
[0026] For the second exon of the long oyster target gene SMYD5 (GeneID: 105330417), the sgRNA target site was designed online, which is GGCTGCTGCTTACGAAGAGAGGG, where the PAM sequence is GGG; the specific steps are as follows: design a forward primer Sg-smyd1F , the primer sequence is 5'-GATCACTAATACGACTCACTATA GGCTGCTGCTTACGAAGAGAGTTTTAGAGCTAGAAAT-3' (including the T7 promoter sequence), using the DR274 plasmid (Addgene plasmid 42250) as a template, using the forwar...
PUM
Property | Measurement | Unit |
---|---|---|
diameter | aaaaa | aaaaa |
angle | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com