Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Preparation method of trace biological sample DNA template and kit for detecting HSV infection of eye

A biological sample, trace technology, used in the determination/inspection of microorganisms, biochemical equipment and methods, recombinant DNA technology, etc., can solve the problem that blood tests cannot accurately reflect the real cause of the eye, lack of high-sensitivity detection of eye tissue virus infection means, not seen, etc.

Active Publication Date: 2018-12-07
PEKING UNIV THIRD HOSPITAL
View PDF1 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

The technical effect of this patented technology lies on providing an easy-to use tool with which we could easily test if there were any virus like herpes (HSV) bacteria found around us during our stay. This would help healthcare workers identify who had these germs earlier when they are sick but still have them right now through testing methods such as ELISA.

Problems solved by technology

This patents discuss different techniques for diagnosing eye condition related illnesses like blepharchea syndrome due to bacteria called cytomegic streptocolyscepticum (CST). These techniques involve collecting tiny amounts of patient's own bodily fluorescences during examination without any specialized equipment. They also require expensive reagents and time-consumption laboratory analysis. Therefore, these technical problem addressed in the current study text relates to developing an improved technique for diagnosis of eye disorders through nonclinical screenings obtained from human retinas.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Preparation method of trace biological sample DNA template and kit for detecting HSV infection of eye
  • Preparation method of trace biological sample DNA template and kit for detecting HSV infection of eye
  • Preparation method of trace biological sample DNA template and kit for detecting HSV infection of eye

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0092] Example 1. Method for extracting DNA from test specimens of eye microfluidics

[0093] Material:

[0094] Specimens to be tested: collected from admitted patients, tear fluid, aqueous humor 2, and vitreous.

[0095] (1) Put the collected sample to be tested into a container, add 10-30 μl proteinase K, 100-300 μl lysis buffer AL, and treat at 56°C for more than 10 minutes;

[0096] (2) Add the same volume of absolute ethanol as the lysis buffer, shake and mix for 10-20s, and centrifuge briefly;

[0097] (3) Put the liquid obtained in step (2) into a spin column, put it into a 2ml collection tube, and centrifuge at 6000-9000rpm for 0.5-2min;

[0098] If the sample volume > 140 μl, repeat step (3);

[0099] (4) Add 300-600μl elution buffer 1, 6000-9000rpm, 0.5-2min, discard the filtrate and collection tube, and replace with a new collection tube;

[0100] (5) Add 300-600μl Elution Buffer 2, centrifuge at 10000-15000rpm for 1-5min, discard the filtrate and collection tu...

Embodiment 2

[0108] Example 2. Method for extracting DNA from eye trace solid specimens to be tested

[0109] Material:

[0110] Specimens to be tested: collected from admitted patients, corneal endothelium, pterygium, conjunctival secretions, eye tumors, the collection volume is about 1×1mm;

[0111] step:

[0112] (1) Put the collected sample to be tested into a container, add 10-30 μl proteinase K, 100-300 μl lysis buffer AL, and treat at 56°C for 6-12 hours;

[0113] (2) Add the same volume of absolute ethanol as the lysis buffer, shake and mix for 10-20s, and centrifuge briefly;

[0114] (3) Put the liquid obtained in step (2) into a spin column, put it into a 2ml collection tube, and centrifuge at 6000-9000rpm for 0.5-2min;

[0115] (4) Add 300-600μl elution buffer 1, 6000-9000rpm, 0.5-2min, discard the filtrate and collection tube, and replace with a new collection tube;

[0116] (5) Add 300-600μl Elution Buffer 2, centrifuge at 10000-15000rpm for 1-5min, discard the filtrate and ...

Embodiment 3

[0125] Embodiment 3. is used for the test kit that detects eye HSV infection by eye microsample

[0126] DNA extraction reagent set:

[0127] Lysis buffer: Tris-saturated phenol with 10% SDS,

[0128] Elution buffer 1: a mixture of saturated phenol: chloroform: isoamyl alcohol with a volume ratio of 25:24:1;

[0129] Elution buffer 2: absolute ethanol,

[0130] Elution buffer 3: pH 8.0, 10 mmol / L Tris-HCl solution containing 1 mmol / LEDTA.

[0131] Specific primers and probes for PCR amplification

[0132] Primer-F: CCATAAACTGGGAGTAGCGGT

[0133] Primer-R: GTGGTCTTCAAGGAGAACATC

[0134] Probe: CGCCCCGTACAAGTTCAAGG

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a preparation method of a trace biological sample DNA template and a kit for detecting HSV infection of an eye, and relates to a molecular detection technology for eye viral infections, in particular to a method for extracting DNA from a race biological sample, wherein the trace biological sample refers to a liquid sample with a volume not exceeding 10mu l-200mu l or a solid sample with a volume not exceeding 1mm<3>. By use of the extracted DNA as a PCR detection template, the eye viral infections can be detected with an accuracy of more than 80%, and the method provides a reliable basis for subsequent appropriate treatment methods and reduces the blindness of the treatment methods.

Description

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Owner PEKING UNIV THIRD HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com