Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Construction of gene expression vector Wxb-10T, preparation of transgenic rice and primer

A technology of transgenic rice, wxb-10t, which is applied in the field of plant genetic engineering, can solve the problems of time-consuming gene resources, singleness, etc., and achieve the effects of improving eating taste, improving eating quality, and reducing the viscosity value of rice starch.

Active Publication Date: 2018-12-07
YANGZHOU UNIV
View PDF1 Cites 10 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

wxya There are multiple important allelic variation sites in the gene, currently wxya mp and wxya op Alleles are excellent genetic resources widely used in conventional soft rice varieties, but these genes are mainly used for breeding applications through hybridization and molecular marker-assisted selection. This process is time-consuming and the genetic resources are relatively single

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction of gene expression vector Wxb-10T, preparation of transgenic rice and primer
  • Construction of gene expression vector Wxb-10T, preparation of transgenic rice and primer
  • Construction of gene expression vector Wxb-10T, preparation of transgenic rice and primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 The acquisition of DNA sequence and the construction of gene expression vector

[0032] According to the whole genome information of rice, the wxya b After the coding sequence of the allele, design specific primer pairs in two sections wxya b The genome was amplified (the first pair of primers 5'TAAGCTTTAGATCCGCTGCCGCCCCGAAT3', SEQ ID NO.3; and 5'CGCCTGCAAAGAACACAAGAACACAACATT3', SEQ ID NO.4; the second primer for site-directed mutagenesis 1 5'AACAATTCAATTCAGTGCAGAGATCTTCCACA3', SEQ ID NO.5 ; CCATGACGTCAGAGCCCTTCTGTTCC3', SEQ ID NO.6; and site-directed mutagenesis primer 2 5'GGAACAGAAGGGCTCTGACGTCATGG3', SEQ ID NO.7; 5'TGGTACCTGAACTTGACGTAGACAGACGTACGATA3', SEQ ID NO.8) for wxya b Construction of site-directed replacement of functional bases in exon 10. The amplified sequences are shown as SEQ ID NO.1 and SEQ ID NO.2.

[0033] Take the young rice leaves of japonica Nipponbare to extract rice genomic DNA by CTAB method, use 1 μL of DNA as a template, and ...

Embodiment 2

[0035] Example 2 contains wxya b -10T Breeding and identification of expression vector transgenic rice

[0036] Rice tissue culture and Agrobacterium-mediated transformation procedures are all carried out by the method established in the inventor's laboratory (Liu Qiaoquan, etc., the establishment of rice efficient transformation system mediated by Agrobacterium tumefaciens, Plant Physiology, 1998, 24 (3) : 259~271). Using Nipponbare mature embryos as explants, callus was induced on N6D2 medium as the transformation recipient, and the constructed RNA interference construct was introduced into rice callus through Agrobacterium-mediated; co-cultured on co-culture medium N6D2C After 3 days, the callus was transferred to N6D2S1 selection medium for screening for about 14 days, and then screened on N6D2S2 selection medium, and the times and days of selection were adjusted according to the actual growth of the callus. A lot of resistant calli were obtained, and after pre-differe...

Embodiment 3

[0037] Example 3 Quality performance of transgenic rice

[0038] Measure the amylose content of rice according to the document method numbered NY147-88 promulgated by the Ministry of Agriculture. Accurately weigh 50 mg of rice flour on a ten-thousandth balance and put it into a 50 ml test tube, add 0.5 ml of absolute ethanol to disperse the sample , then add 4.5ml of 1.0 mol / l NaOH solution and mix well, put in boiling water bath for 20 min, then cool to room temperature, and distilled water to make up to volume. Take 5 ml of digestion solution, add it to a 100mL volumetric flask filled with half a bottle of distilled water, then add 1.0 ml of 1.0 mol / l acetic acid solution to acidify the sample; add 1.5 ml of 0.02% iodine solution, dilute to volume with distilled water, and shake well After standing still for 15 minutes; add 0.5ml of 95% ethanol to 4.5ml of 1N NaOH to replace the sample, and prepare a blank solution. Use the blank solution to adjust the zero point of the spe...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of biology and relates to construction of a gene expression vector Wxb-10T, preparation of transgenic rice and a primer. The primer is shown in a sequencetable of SEQ ID NO. 3-8. The allele Wxb in the conventional japonica rice serves as a template, and the rice expression vector Wxb-10T substituted by single nucleotides at the tenth exon of the alleleis constructed. The vector carries a full-length Wxb allele sequence with single base mutation, and by utilizing an agrobacterium tumefaciens mediated method, the transgenic rice with transgenosis ofWxb-10T in glutinous rice is obtained. The transgenic rice of a homozygous line is bred, the amylose content of the transgenic rice is generally about 12%, and the gel consistency and starch viscosity index of the transgenic rice are close to those of currently popular excellent edible soft rice. The method is realized by introducing a rice expression vector modified by specific nucleotide sitesof granule-bound starch synthase GBSSI coding genes Wx into the glutinous rice.

Description

technical field [0001] The invention belongs to the field of plant genetic engineering, in particular, the invention relates to a method of modifying wxya The specific base site of the gene reduces the function of the encoded protein (enzyme) appropriately, and uses it to regulate the amylose content of rice, and is used in the breeding of rice with excellent soft rice quality. Background technique [0002] Rice ( Oryza sativa L.) is an important food crop in my country. The evaluation indicators of rice quality generally include: milling quality, appearance quality, nutritional quality, and cooking and eating quality, the most critical of which are cooking and eating quality (Rao et al., Plant Cell Reports, 2014, 33(4):551- 564; Zhang Changquan et al., Chinese Agricultural Sciences, 2016, 49(22): 4267-4283.). The conventional evaluation indicators of cooking and eating quality include amylose content (AC), gel consistency (gel consistency, GC), and gelatinization tempe...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12N15/82C12N15/54A01H5/10A01H6/46
CPCC12N9/1051C12N15/8245C12Y204/01021
Inventor 刘巧泉张昌泉范晓磊李钱峰陆彦陈盛杰
Owner YANGZHOU UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com