Construction method of Pdzd7 gene mutant animal model
A technology for animal models and construction methods, applied in the fields of botanical equipment and methods, biochemical equipment and methods, and other methods of inserting foreign genetic materials, which can solve problems such as lack of simulation and simulation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0018] Embodiment 1: The construction method of Pdzd7 gene mutation animal model based on CRISPR / Cas9 technology is realized by the following steps:
[0019] (1) Selection and design of Guide RNA targeting mouse Pdzd7 gene
[0020] Design the Pdzd7 gene mutant mouse construction strategy, such as figure 1 shown.
[0021] According to the construction strategy, a suitable Guide RNA is designed at the corresponding position of the Pdzd7 gene, wherein the nucleotide sequence of Guide RNA target site1 is shown in SEQ ID NO.1, and the nucleotide sequence of Guide RNA target site2 is shown in SEQ ID NO.2 The specific sequence is as follows:
[0022] sgRNA name
sequence
PAM
Guide RNA target site1
ACAGGAGGTGGCTGGGGAGG
AGG
Guide RNA target site2
GAGGAGGTGCGCATGCGCCT
GCC
[0023] (2) In vitro synthesis of Guide RNA and Cas9 mRNA
[0024] Guide RNA and Cas9 mRNA were synthesized by Sangon Bioengineering (Shanghai) Co., Ltd.
[0025...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com