A rice exogenous stress-induced expression promoter psubs3 and its application
A promoter, rice technology, applied in the fields of biotechnology and plant genetic engineering, can solve the problems of material and energy waste, affecting the normal growth and development of plants, and achieve the effects of enhancing viability, improving flood tolerance, and increasing expression.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0034] Step 1, promoter Psubs3 cloning and pCAMBIA1381-Psubs3 vector construction
[0035] According to the whole genome sequence of rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided by NCBI, the amplification primers were designed according to the sequence in the sequence table SEQ ID No.1, and the primers were designed according to the characteristics of the selected vector and target gene. Restriction sites. Primers used for amplification were:
[0036] Forward primer: EcoRI GAATTCTTTTACTCACCGTGTCCTCTGTT
[0037] Reverse primer: HindIII AAGCTTTGTATCTCCTCTCTGGTAGTTAG
[0038] Using the rice variety Nipponbare DNA as a template, using the forward primer and reverse primer to amplify the promoter Psubs3, according to the conventional PCR system, the following amplification procedure was adopted:
[0039] Pre-denaturation at 95°C for 5min; denaturation at 95°C for 30s, annealing at 58°C for 30s, extension at 72°C for 2min and 30s, 35 cycles from pre-denaturati...
Embodiment 2
[0052] 1. Obtaining the POssalt2 promoter containing restriction sites
[0053] (1) Design of primers
[0054] According to the whole genome sequence of rice variety Nipponbare (Oryza sativa L cv. Nipponbare) provided by NCBI. Amplification primers are designed according to the promoter sequence of SEQ ID No.2 in the sequence table, and restriction enzyme cutting sites of the primers are designed according to the characteristics of the selected vector and target gene. In this example, the rice binary expression vector pCAMBIA1381 (from pCAMBIA, a publicly available vector, preserved by the Rice Group of the Supervision, Inspection and Testing Center for Components of Transgenic Biological Products, Ministry of Agriculture, Anhui Academy of Agricultural Sciences) is taken as an example. The target gene is the GUS gene. Specifically designed The primer sequences are as follows, the bases in italics are restriction sites:
[0055] Forward primer: GAATTCAATTCCTACTACTTAAATTCCAEco...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com