Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Chimeric antigen receptor of targeted mesothelin and method and use for jointly expressing IL-15

A single-chain antibody, fusion protein technology, applied in the direction of targeting specific cell fusion, peptides containing localization/targeting motifs, receptors/cell surface antigens/cell surface determinants, etc., can solve the biological problems of Mesothelin. Function is not clear, etc.

Active Publication Date: 2018-11-02
HRAIN BIOTECHNOLOGY CO LTD
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The biological function of Mesothelin has not yet been clarified

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chimeric antigen receptor of targeted mesothelin and method and use for jointly expressing IL-15
  • Chimeric antigen receptor of targeted mesothelin and method and use for jointly expressing IL-15
  • Chimeric antigen receptor of targeted mesothelin and method and use for jointly expressing IL-15

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0075] Example 1: Determination of Mesothelin CAR-mbIL15 gene sequence

[0076] The human IL15 and IL15Rα mature peptide sequence information was searched from the NCBI website database, and the sequence was codon-optimized on the website http: / / sg.idtdna.com / site to ensure that it is more suitable for human cells without changing the encoded amino acid sequence Express.

[0077] For the sequence information of each gene, see SEQENCE LISTING (SEQUENCE ID NO.1-2)

[0078] The above sequences were connected sequentially, and different enzyme cutting sites were introduced at the junctions of each sequence to form the complete MesothelinCAR-mbIL15 gene sequence information.

Embodiment 2

[0079] Embodiment 2: the construction of the viral vector comprising the nucleic acid sequence of CAR molecule

[0080] The nucleotide sequence of the CAR molecule prepared in Example 1 was double-digested by NotI (NEB) and EcoRI (NEB), connected by T4 ligase (NEB) and inserted into the NotI-EcoRI position of the retroviral RV vector (MSCV) point, transformed into competent E.coli (DH5α), the recombinant plasmid was sent to Shanghai Sangon Biotechnology Co., Ltd. for sequencing, and the sequencing results were compared with the fitted Meso CAR-mbIL15 sequence to verify whether the sequence was correct.

[0081] The sequencing primers are:

[0082] Sense sequence: AGCATCGTTCTGTGTTGTCTC (SEQUENCE ID NO.3)

[0083] Antisense sequence: TGTTTGTCTTGTGGCAATACAC (SEQUUNCE ID NO.4)

[0084] After the sequencing was correct, the plasmid was extracted and purified using a plasmid purification kit from Qiagen, and the purified plasmid was transfected into 293T cells by the plasmid calci...

Embodiment 3

[0086] Example 3: Retroviral Packaging

[0087] 1. On the first day, the 293T cells should be less than 20 passages and not overgrown. Plate with 0.6*10^6 cells / ml, add 10ml of DMEM medium to a 10cm dish, mix the cells well, and culture overnight at 37 degrees;

[0088] 2. On the second day, the confluence of 293T cells reaches about 90% for transfection (usually about 14-18 hours after plating); prepare plasmid complexes, the amount of various plasmids is 12.5ug for Retro backbone, 10ug for Gag-pol, and 10ug for VSVg 6.25ug, CaCl 2 250ul,H 2 O is 1ml and the total volume is 1.25ml; add HBS equal to the volume of the plasmid complex in another tube, and vortex for 20 seconds while adding the plasmid complex. Gently add the mixture to the 293T dish along the side, incubate at 37°C for 4 hours, remove the medium, wash it with PBS, and add pre-warmed fresh medium again.

[0089] 3. Day 4: 48 hours after transfection, collect the supernatant and filter it with a 0.45um filter...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chimeric antigen receptor mMesothelin scFv-CD8H&M-CD28-41BB-CD 3zeta-mbIL15 and use thereof. The chimeric antigen receptor is formed by series connection of a light chain andheavy chain variable region (MesothelinscFv) of an anti-mouse Mesothelin monoclonal antibody (with a cloning number being SS1), a human CD8alpha hinge region, a human CD8 transmembrane region, a human CD28 and 41 BB intracellular region, a human CD3zeta intracellular region and an IL15+IL15Ralphla structure. The Meso-mbIl15 CART cell prepared by the invention has a strong killing function on specific tumor cells; and the prepared Meso-mbIl15 CART cell has very good multiplication capacity.

Description

technical field [0001] The invention belongs to the field of chimeric antigen receptors, and in particular relates to chimeric antigen receptors targeting mesothelin and uses thereof. Background technique [0002] Pancreatic cancer (Pancreatic Carcinoma) is a clinically common malignant tumor of the digestive system, which is more common in people over 50 years old. There are obvious regional differences in its incidence rate. In recent years, the incidence rate has gradually increased. It has become the fourth most common malignant tumor in European and American countries, ranking second in the cause of death of digestive tract cancer, second only to colorectal cancer, and its incidence is hidden. , Early symptoms are non-specific, and the surgical resection rate is low. In the process of tumorigenesis and development, the activation of many genes and the expression of their products play an important role, and the exact molecular mechanism is not completely clear. With th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C12N15/867C12N7/01C12N5/10C07K19/00A61P35/00
CPCA61K35/17C07K14/7051C07K16/303C07K2319/02C07K2319/33C12N5/0636C12N7/00C12N15/86C12N2510/00C12N2740/10021C12N2740/10043
Inventor 黄飞金涛王海鹰何凤史子啸
Owner HRAIN BIOTECHNOLOGY CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com