Fluorescent quantitative PCR (Polymerase Chain Reaction) kit for detecting novel duck reovirus and application
A reovirus and fluorescence quantitative technology is applied in the field of avian virus detection, which can solve the problems that the new duck reovirus cannot be detected, the new duck reovirus has not been detected, and cannot be quantified, and achieves high sensitivity, Loss-reducing, specific effects
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0056] Embodiment 1: the design of fluorescence quantitative PCR primer and probe
[0057] According to the second-generation sequencing technology, the whole genome sequence of the new duck reovirus (preservation number is CCTCC NO: V201818) was obtained. In the whole genome sequence, L1, L2, L3, M1, M2, M3, S1, S2, S3, S4 are The sequences of the 10 gene fragments are respectively shown in SEQ ID NO.4-SEQ ID NO.13.
[0058] Design specific primer sequences and fluorescent probe sequences for the sequence conserved region of the M1 gene, the sequence design is as follows:
[0059] Forward primer: M1-F: ATTATCCATTTTGAGATCCACG; (SEQ ID NO.1)
[0060] Reverse primer: M1-R; TTGGTTGCTTTCCTAGCGCTT; (SEQ ID NO.2)
[0061] Fluorescent probe: 5'-FAM-TGCGAGTCGGTTCTAGTCGCA-TMARA-3'; (SEQ ID NO.3)
[0062] The 5' end of the fluorescent probe is labeled with a fluorescent reporter group FAM, the 3' end is labeled with a fluorescent quencher group TMARA, and the length of the amplified ...
Embodiment 2
[0063] Example 2: Establishment of Fluorescent Quantitative PCR Detection Method
[0064] (1) Extraction of viral RNA:
[0065] Extract the total RNA of the sample to be tested using the classic Trizol method or a commercial kit;
[0066] (2) Establishment of fluorescent PCR reaction system:
[0067] The one-step fluorescence quantification kit used adopts the One StepPrimerScript from Takara Company whose article number is RR064A TM RT-PCR Kit kit, add 2×One Step RT-PCR BufferⅢ~10μl, 1×TaKaRa Ex Taq HS(5U / μl)~0.4μl, PrimeScript RT EnzymeMixⅡ~0.4μl, PCR Forward Primer (10μM) ~ 0.4μl, PCR Reverse Primer (10μM) ~ 0.4μl, Probe ~ 0.8μl, ROX Reference Dye or DyeⅡ (50×) ~ 0.4μl, Total RNA of the sample to be tested extracted in step (1) ~ 2 μl, using RNase Free dH 2 O supplemented to 20μl system. Placed in ABI 7300Fast fluorescent quantitative PCR instrument for reaction, the reaction conditions were 42°C for 5min; 95°C for 10s; then 95°C for 5s and 60°C for 34s for 40 cycles. ...
Embodiment 3
[0075] Example 3: The composition of the kit, the optimization of experimental parameters and the investigation of specificity, sensitivity and repeatability
[0076] 1. The composition of the kit:
[0077] The kit in this example is a fluorescent quantitative PCR kit, which is used to detect a new type of duck reovirus (preservation number is CCTCC NO: V201818). The kit contains: the forward primer (10 μM) shown in SEQ ID NO.1 designed in Example 1, the reverse primer (10 μM) shown in SEQ ID NO.2 designed in Example 1, and the reverse primer (10 μM) shown in SEQ ID NO.2 designed in Example 1 The probe shown in SEQ ID NO.1, a standard and a fluorescent quantitative PCR reaction reagent.
[0078] Standards were prepared as follows:
[0079] The primers shown in SEQ ID NO.1-SEQ ID NO.2 were used to amplify the genome of the duck reovirus whose preservation number is CCTCC NO: V201818, and an 80bp amplification product (shown in SEQ ID NO.14) was obtained. The amplified produc...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com