Common wild rice root-specific promoter orrsgp and its application

A promoter, rice root technology, applied in the field of plant genetic engineering

Active Publication Date: 2020-07-14
THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Common wild rice is the close ancestor species of cultivated rice, with perennial root reproduction and well-developed root system. Extensive research has been carried out on drought resistance and other aspects, but there are no reports of root-specific expression genes and promoters (Zhou Shaoxia. Drought-resistant introgression line of common wild rice in Dongxiang, Jiangxi Construction and drought-resistant gene mapping[J]. Beijing: China Agricultural University, 2005.)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Common wild rice root-specific promoter orrsgp and its application
  • Common wild rice root-specific promoter orrsgp and its application
  • Common wild rice root-specific promoter orrsgp and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] Example 1. Cloning of OrRSGp specific expression fragment from Oryza sativa root

[0028] The genomic DNA of common wild rice was extracted by the CTAB method as a template, and the following amplification primers FP and RP were used as primers for PCR amplification. The reaction system was 50 μL.

[0029] Amplification primer sequence:

[0030] FP: 5'ACGCGTAAGGGGATCCTGGCAAAGCAAGGATTGCTTA 3';

[0031] RP:5’GATCTACCATGAATTCCATGTTTCAAATCAGAGTGATTATCC 3’

[0032] The above PCR amplification reaction procedure is: 95°C pre-denaturation for 30sec, then 95°C denaturation for 30sec, 60°C annealing for 30sec, 72°C extension for 30sec, 35 cycles, and finally complete extension for 5min.

[0033] A 896bp PCR product was obtained, which was separated by 1.5% agarose gel electrophoresis ( figure 1 ), the fragment is recovered, after sequencing, the nucleotide sequence of the PCR product is sequence 1, and the fragment shown by the PCR product is named OrRSGP.

[0034] The above 50μL reaction s...

Embodiment 2

[0038] Example 2. Study on the function of OrRSGp specific expression fragment from Oryza sativa root

[0039] 1. Preparation of recombinant vector

[0040] The recombinant vector pBinGlyRed-GUS-OrRSGp used for transformation of Arabidopsis thaliana is to replace the OrRSGp shown in sequence 1 with pBinGlyRed-GUS (Zhao Zhiqiang et al., Cloning and identification of the promoter specific expression in the green tissue of common wild rice. Biotechnology Bulletin, 2017, ( 7): 51-57) The aMV35S promoter that drives GUS expression between the BamH I and EcoR I restriction sites of the vector to obtain the vector.

[0041] The recombinant vector pCAMBIA1305-OrRSGp used for rice transformation is to replace the OrRSGp shown in sequence 1 with pCAMBIA1305 (Wuhan Miaoling Biotechnology Co., Ltd., P1117, and the vector contains the GUS gene) vector to drive GUS expression between HindIII and NcoI sites aMV 35S promoter, the resulting vector.

[0042] 2. Application of promoter fragments to reg...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a common wild rice root specific promoter OrRSGp and application thereof. The invention provides a DNA molecule which is any one of NDA molecules of 1)-3) as follows: 1) a DNAmolecule of which an encoding zone is shown in sequence 1 in a sequence table; 2) a DNA molecule which is hybridized with a DNA sequence defined by 1) under a strict condition and has functions same as those of the DNA sequence; 3) a DNA molecule which has at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% of homology with the DNA sequence defined by 1) and has functions same as those ofthe DNA sequence. According to the common wild rice root specific promoter OrRSGp, one root specific promoter is obtained from a common wild rice genome through separation, and transgenosis GUS analysis shows that a segment of the promoter has a root-specific activity.

Description

Technical field [0001] The invention relates to the field of plant genetic engineering, in particular to OrRSGp, a common wild rice root-specific promoter and its application. Background technique [0002] Promoter refers to the region on the DNA molecule that is recognized by RNA polymerase, transcription regulators, etc. and combined to form a transcription initiation complex. Promoters play a very important role in the initiation and regulation of gene transcription (Li Y, Sun Y, Yang Q, et al. Cloning and function analysis of an alfalfa (Medicago sativa L.) zincfinger protein promoter MsZPP[J]. Mol Biol Rep, 2012, 39: 8559-8569.). Promoters can be divided into three categories: constitutive, specific and inducible. Constitutive promoters are widely used in genetic engineering. Such as the cauliflower (Brassicaoleracea var.botrytis) mosaic virus (CaMV) 35S promoter (Odell JT, Nagy F, and ChuaNH.et.al.Identification of DNA sequences required for activity of the cauliflower m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/82C12N15/11A01H5/06A01H6/20
CPCC07K14/415C12N15/8227
Inventor 裴新梧龙艳黄珂薛满德
Owner THE INST OF BIOTECHNOLOGY OF THE CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products