Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A gene molecular marker, detection method and kit related to yak physique

A molecular marker and yak technology, applied in the field of molecular biology, can solve the problems of low yak production performance, failure to improve yak quality and production performance, etc.

Inactive Publication Date: 2021-08-10
LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the breeding work, conventional breeding methods have been greatly restricted. Various methods such as interspecific hybridization and breeding of this variety have been used in yak production areas to improve the production performance of yaks. Influenced by factors such as unsystematic production performance and pedigree records, these methods have not achieved the purpose of improving yak quality and production performance. Yak is still a primitive breed of cattle with low production performance.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A gene molecular marker, detection method and kit related to yak physique
  • A gene molecular marker, detection method and kit related to yak physique
  • A gene molecular marker, detection method and kit related to yak physique

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0030] The yaks (Bos grunniens) used in this experiment originated from Luqu County, Gansu Province. Three generations of yaks were randomly selected as population samples. 28 animals (average age 50±6.3 months, male and female 13 and 15 respectively), three generations of 42 animals (average age 16±4.4 months, male and female 20 and 22 respectively), a total of 95 samples.

[0031] DNA extraction

[0032] Methods: 10 mL / head of yak blood sample was collected from the jugular vein, anticoagulated with ACD, and stored at -20°C for later use. Genomic DNA was extracted from frozen blood samples by the phenol-chloroform method.

[0033] PCR amplification

[0034] According to the yak (Bos grunniens) MMP3 gene sequence (GenBank No.NW_005392917.1), a partial sequence template is shown in SEQ ID NO.1;

[0035] ccgatgtgggattcctgacgttggtttcttcagcacctttcctggggagcccaagtggaagaaaactcacctcacgtacaggtaatgggtccaaagagatttttacatactatgagattttataaattactattacaggagaaaatagtatctttattattactttttt...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a gene molecular marker related to yak physique, a detection method and a kit, and belongs to the technical field of molecular biology. The invention analyzes the genetic polymorphism of the yak MMP3 gene to find a SNP site of the MMP3 gene that can affect the physique of the yak; the invention also provides a PCR method for detecting the SNP site. Molecular breeding of yak can be better carried out by the above method.

Description

technical field [0001] The invention relates to a yak physique-related gene molecular marker, detection method and kit, belonging to the technical field of molecular biology Background technique [0002] Animal molecular breeding is an emerging discipline that uses the theory and technology of molecular quantitative genetics to improve livestock and poultry breeds, and is a new development of traditional animal breeding theories and methods. Judging from the current development status, it should include two aspects: Genomic breeding and Transgenic breeding. Among them, genome breeding is based on genome analysis, using DNA marker technology to directly select quantitative trait loci of livestock and poultry, or introducing favorable genes through marker assistance, and eliminating unfavorable genes through marker assisted elimination (Mar-ker assisted culling, MAC) etc., in order to achieve the purpose of improving livestock and poultry more effectively. Transgenic breedin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 郭宪裴杰包鹏甲吴晓云熊琳褚敏丁学智王宏博阎萍梁春年
Owner LANZHOU INST OF ANIMAL SCI & VETERINARY PHARMA OF CAAS
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com