Mandarin fish gamma interferon relevant factor as well as recombinant protein and application thereof
A related factor, gamma interferon technology, applied in mandarin fish gamma interferon related factor and its recombinant protein and application field, can solve unseen problems
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Mandarin fish gamma interferon-related factor IFN-γrel ORF full-length preparation:
[0027] 1. Template Preparation
[0028] RNA was extracted from mandarin fish by Trizol method, and cDNA template was obtained by reverse transcription according to the operation steps of RevertAid First Strand cDNA Synthesis Kit (Thermo, K1622). 5'-RACE was prepared with 5'-Full RACE Kit, and 3'-RACE was prepared with SMARTTM RACE cDNA Amplification Kit. cDNA at the end of RACE.
[0029] 2. PCR amplification
[0030] Firstly, the degenerative primers Sc-IFN-γrelDF and Sc-IFN-γrelDR were used to amplify the intermediate fragment with cDNA as a template for sequencing verification, and SMART cDNA was obtained;
[0031] Degenerate primers for amplifying the middle fragment:
[0032] TPREL-F1BKB:5>ACRAWCGCATTTTCTCCAGCAT<3
[0033] TPREL-F2BKB:5>YAACACCTCCTGCCAGAGA<3
[0034] TPREL-R2BKB:5>ACTCAGCCAGAGCTCTCTTCTG<3
[0035] TPREL-R1BKB:5>CYWKGWACTCAGCCAGAGCT<3
[0036] TPREL-F3BKB:5>T...
Embodiment 2
[0050] Construction of IFN-γrel prokaryotic expression plasmid and protein purification
[0051] The software predicts that the IFN-γrel signal peptide is removed, and the forward and reverse primers are designed to use IFN-γrel-PEX-F with an EcoRI restriction site as the forward primer, and IFN-γrel-PEX-R with an XhoI restriction site Using PMD18T-IFN-γrel as a reverse primer, amplified fragments with enzyme cleavage sites were amplified. Then use EcoRI and XhoI two fast cutting enzymes to simultaneously digest the amplified target fragment and the pET28a(+) plasmid. After digestion, the IFN-γrel and pET28a(+) plasmids are ligated with T4 ligase at 25 degrees for 30 minutes, and enzymes at 65 degrees Inactivate for 10 minutes, and finally transform the ligation product into DE3 expression bacteria. After PCR and sequencing verification, the positive transformants successfully constructed IFN-γrel into the pET28a(+) expression vector, and the obtained strain was named pET28a(+...
Embodiment 3
[0064] Application of IFN-γrel Recombinant Protein in Preparation of Immunomodulator
[0065] The preparation of mandarin fish kidney leukocytes: first wet the 15ml centrifuge tube wall with bovine serum; add 4ml premixed 51% Percoll (2.04ml Percoll stock solution, 0.4ml NaCl, 1.54ml sterilized water, 800U Heparin) into the centrifuge tube ). When adding liquid, the 15ml centrifuge tube is tilted, and the tip of the 1ml pipette should be close to the tube wall, and the flow rate should be slow to prevent a large momentum. Then add 4ml premixed 34% Percoll (1.36ml Percoll stock solution, 0.4ml NaCl, 2.22ml sterilized water, 800U Heparin) in the same way.
[0066] The mandarin fish head kidney that will be taken out in aseptic environment is placed on the pre-cooled DMEM culture medium (containing 2% fetal bovine serum, 100U / ml penicillin, 100 μ g / ml streptomycin, 10U / ml Heparin) rapidly; Cut the head kidney into small pieces with scissors in Taichung, wash the tissue piece tw...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap