Detection method of low requency mutated DNA fragment and library building method
A low-frequency mutation and detection method technology, applied in the field of genetic engineering, can solve the problems of low efficiency of capturing DNA fragments, low sensitivity, low detection limit, etc., and achieve the effect of improving sensitivity, improving sensitivity, and simple steps.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0065] In this example, the target detection gene is exon 18 of the EGFR gene, and the library construction process is as follows: figure 1 shown, follow the steps below:
[0066] (1) First, perform targeted sequencing on exon 18 of the EGFR gene, according to figure 2 Based on the principle, specific primers are designed for exon 18 of EGFR. The number of templates that can be used by the primers in this example is much higher than that of traditional methods, which increases the number of effective templates for capture and improves the detection sensitivity of low-frequency mutation samples.
[0067] The sequence of exon 18 of EGFR is as follows:
[0068] CTTGTGGAGCCTCTTACACCCAGTGGAGAAGCTCCCAACCAAGCTCTCTTGAGGATCTTGAAGGAAACTGAATTCAAAAAGATCAAAGTGCTG GG CTCCGGTGCGTTCGGCACGGTGTATAAG
[0069] Wherein the underlined base is the mutation site;
[0070] The sequences of exon 18 of EGFR and its upstream and downstream introns are as follows:
[0071] CAGTTAATAGGCGTGGAAACAGAC...
Embodiment 2
[0122] Embodiment 2 of the present invention is to test the detection limit of the detection method, according to the following steps:
[0123] (1) Low-frequency mutation standard preparation:
[0124] The cfDNA standard (Horizon Discovery, HD780) was used to detect the L858R site of exon 21 of the EGFR gene. The mutation frequencies were 0%, 0.1%, 1%, and 5%, respectively, and were named: S0, S1, S2, and S3.
[0125] (2) Library construction:
[0126] S0, S1, S2, and S3 were respectively captured according to the hybrid capture method in Example 1, and the subsequent steps were carried out according to the steps in Example 1 for library construction.
[0127] (3) qPCR quality inspection and on-machine sequencing:
[0128] The library was subjected to qPCR quality control and on-machine sequencing according to the method in Example 1.
[0129] Experimental results:
[0130] 1) Library electrophoresis detection and analysis results:
[0131] According to the results of ele...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap