Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of combination of N-Myc inhibiting agent and Olaparib to preparation of medicine for treating prostatic cancer

A technology for prostate cancer and therapeutic drugs, applied in the field of medicine, can solve the problem of difficult to inhibit the malignant progression of tumors, and achieve the effects of inhibiting proliferation and clone formation, inhibiting growth and enhancing sensitivity

Inactive Publication Date: 2018-04-20
SHANGHAI CHANGHAI HOSPITAL
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In order to overcome the existing castration-resistant prostate cancer treatment methods that are difficult to inhibit the malignant progression of tumors, and the limitations and drug resistance of olaparib in the treatment of prostate cancer, the purpose of the present invention is to provide a new drug for N-Myc inhibitors use

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of combination of N-Myc inhibiting agent and Olaparib to preparation of medicine for treating prostatic cancer
  • Application of combination of N-Myc inhibiting agent and Olaparib to preparation of medicine for treating prostatic cancer
  • Application of combination of N-Myc inhibiting agent and Olaparib to preparation of medicine for treating prostatic cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0046] Spread the prostate cancer cell lines C4-2b4 and NCI-H660 in a 6-well plate, and when the cell density reached 75%, they were respectively transfected with three kinds of interfering RNA (NCsi sequence: UUCUCCGAACGUGUCACGUUU (SEQ ID NO.1); MYCNsi-1 sequence: ATGACGCTGATACATAACTAA (SEQ ID NO.2); MYCNsi-2 sequence: CGTGCCGGAGTTGGTAAAGAA (SEQ ID NO.3)). After 24 hours, transfer to 96-well plate, 4×10 per well 3 cells, with 5 auxiliary wells for each group. After the cells adhered to the wall, it was counted as 0 time, the medium was sucked off at 0, 24, 48, 72, and 96 hours respectively, and 20% MTS detection reagent diluted with the medium was added, and the 450nm at 450nm was detected after incubating at 37°C for 1 hour. Absorbance values. Growth curves were drawn using the absorbance values ​​measured at each time point.

[0047] Depend on figure 1 In middle A, it can be seen that 48 hours after interfering with N-Myc, the proliferation rate of prostate cancer cells...

Embodiment 2

[0051] Prostate cancer cell lines C4-2b4 and NCI-H660 were grown in 6-well plates, and when the density reached about 50%, three kinds of interfering RNAs, NCsi, MYCNsi-1 and MYCNsi-2 were transfected respectively, with 3 cells in each group. Accessory hole. After 48 hours, trypsinize the cells (to avoid too long digestion time), gently blow down the cells and transfer them to a centrifuge tube, centrifuge the cells at room temperature (1000g, 5min), discard the supernatant and resuspend the cells with 300μl 1×Binding Buffer, The cells were co-stained with PI and FITC-labeled Annexin-V for 30 min at 4°C in the dark. Subsequently, the percentage of cell apoptosis was detected using the flow cytometer FACSCalibur of BD Company.

[0052] Depend on figure 2 It can be seen that after interfering with the expression of N-Myc, the apoptotic ratio of prostate cancer cells is significantly increased.

Embodiment 3

[0054] Spread the prostate cancer cell lines C4-2b4 and NCI-H660 in a 96-well plate, 4×10 per well 3 cells. After the cells adhered to the wall, they were treated with DMSO, 10058-F4 30 μM, OLA 5 μM, 10058-F4 30 μM+OLA 5 μM, and 5 auxiliary wells were set up for each group. Suck off the medium at 0, 24, 48, 72, and 96 hours respectively, add 20% MTS detection reagent diluted with the medium, and incubate at 37° C. for 1 hour to detect the absorbance at 450 nm. Growth curves were drawn using the absorbance values ​​measured at each time point.

[0055] 10058-F4 combined with Olaparib can significantly increase the inhibitory effect of Olaparib on the proliferation of prostate cancer cells, and this level of inhibition is higher than the sum of cell inhibition caused by 10058-F4 or Olaparib alone.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of medicine. In recent years, cancer genes MYCN (coding N-Myc protein) and signal channels thereof receive more attention in the tumor prevention and treatment and study field. The invention provides application of an N-Myc inhibiting agent to preparation of medicine for treating prostatic cancer, and particularly relates to the application of the combination of N-Myc inhibiting agent and Olaparib to effective inhibition of prostatic cancer (particularly to the growth of castration-resistant prostate cancer). The development of the prostatic canceris reduced; the clinic use and popularization are easy.

Description

technical field [0001] The invention relates to the technical field of medicine, in particular to the application of an N-Myc inhibitor combined with olaparib in the preparation of a drug for treating prostate cancer. Background technique [0002] Prostate cancer (PCa), as a malignant tumor that seriously threatens men's health, accounts for the second in the incidence of tumors and the sixth in the death rate in the world. Most prostate cancers in my country are late when they are discovered, and the tumors have been locally or distantly metastasized; after a median of 18-24 months of endocrine therapy, almost all patients will transform into castration-resistant prostate cancer (CRPC). cancer, CRPC). Its formation mechanism is currently unknown, and there is a lack of effective treatment methods. It is the main cause of death in prostate cancer patients. [0003] Olaparib (Olaparib) is a new type of poly ADP ribose polymerase (PARP) inhibitor, which also acts on BRCA1 or ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K45/06A61K31/502A61K31/7105A61P35/00
CPCA61K45/06A61K31/502A61K31/7105A61K2300/00
Inventor 张威周铁栾阳肖广安孙颖浩
Owner SHANGHAI CHANGHAI HOSPITAL
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com