Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Polynucleotide sequence compositions for controlling pests

A polynucleotide and composition technology, applied in the application, insecticide, animal repellent and other directions, can solve the problems of slow degradation, non-target biological damage, no lack of beneficial organisms, etc., and achieves low cost, simple operation, Good environmental compatibility

Active Publication Date: 2021-07-13
杭州昆成生物科技有限公司
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, chemical pesticides are one of the effective means to prevent and control pests, but the use of chemical pesticides is a double-edged sword, and the following problems will be accompanied by good results: 1) chemical pesticides do not have Target selectivity, when chemical insecticides are applied to control harmful insects, they also cause damage to non-target organisms, some of which are beneficial
2) On the soil where chemical pesticides are applied, it usually shows a barren state for a corresponding period of time
3) Chemical pesticides continue to remain in the environment and degrade slowly, resulting in residues of chemical pesticides in crops and the environment, which will accumulate in the food chain, with humans bearing the brunt as the top of the food chain. The accumulation of these chemical pesticides lead to the induction of various diseases, such as cancer
First, the antisense sequences expressed in transformed cells are unstable
Second, the instability of the antisense sequence expressed in transformed cells

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polynucleotide sequence compositions for controlling pests
  • Polynucleotide sequence compositions for controlling pests
  • Polynucleotide sequence compositions for controlling pests

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1, determination of target sequence

[0026] Step 1. Extracting total RNA of Thrips occulus: Extract RNA from larvae of Thrips larvae by conventional Trizol method, purify by conventional methods, and treat with DNase to obtain concentration ≥ 280 ng / μl, total amount ≥ 10 μg, OD 260 / 280 1.9-2.1 for total RNA samples.

[0027] Step 2. Isolate mRNA and synthesize cDNA: use oligo-dT magnetic beads to isolate mRNA with polyA, and then use random hexamers and Invitrogen kits to synthesize the first strand of cDNA.

[0028] Step 3: Screen out the target sequence, compare with NCBI, and screen out 6 target sequences of Western flower thrips from various metabolic pathways through research and analysis. The corresponding GENBANK accession number is: GT301184, GenBank: GT308845.1 specific information As follows:

[0029] Target sequence 1: GTTACGCTAACGGTCAAATG (SEQ ID NO: 1)

[0030] Target sequence 2: AATGCCTCCTGATTTTGCCAAT (SEQ ID NO: 2)

[0031] Target sequence...

Embodiment 2

[0035] Embodiment 2, the construction of plant expression vector

[0036]According to tomato Ubi promoter-target sequence sense strand-spacer sequence-target sequence antisense strand are connected together, and form expression vector with marker gene Hpt. Both ends of the sense primer have EcoR I and Hind III restriction sites, the antisense primers have Xho I and Sac I restriction sites at both ends, and the spacer primers have Hind III and Sac I restriction sites at both ends location. The recombinant cloning vector containing the sense strand was double-digested, and the sense strand fragment was recovered. The recombinant expression vector XHJM was subjected to the same double digestion to recover the linearized plasmid, and ligated with the target fragment to obtain the recombinant expression vector XHJM-X1. The recombinant expression vector XHJM-X1 was double digested, and the linearized plasmid was recovered. The recombinant cloning vector containing the antisense s...

Embodiment 3

[0038] Embodiment 3, obtaining transgenic tomato

[0039] The correct recombinant expression vectors XHJM-01, XHJM-02, XHJM-03, XHJM-04, XHJM-05 and XHJM-06 were transformed into Agrobacterium EHA105 (Invitrgen, Chicago, USA, CAT: 18313-015), according to the commonly used Agrobacterium infection method, the tomato seedlings cultured aseptically were co-cultured with the Agrobacterium described in the third embodiment, so that the recombinant expression vector XHJM- 01, T-DNA in XHJM-02, XHJM-03, XHJM-04, XHJM-05 and XHJM-06 (including X1 nucleotide sequence, X2 nucleotide sequence, X3 nucleotide sequence, X4 nucleotide sequence sequence, X5 nucleotide sequence, X6 nucleotide sequence, maize Ubi promoter sequence, Hpt gene and Nos terminator sequence) were transferred into the tomato genome, and tomato plants and transgenic plants with X1 nucleotide sequence were obtained. Tomato plant with X2 nucleotide sequence and tomato plant with X3 nucleotide sequence, tomato plant with...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present invention relates to the field of insecticides, specifically, the present invention relates to polynucleotide sequence compositions for controlling pests, said insecticide compositions comprising the polynucleotide sequences shown in SEQ ID NO: 1, 3, 6 or a polynucleotide sequence that hybridizes to the defined polynucleotide sequence under stringent conditions; or a polynucleotide sequence that has more than 80% identity with the defined polynucleotide sequence; or at least 19% of the defined polynucleotide sequence A polynucleotide sequence of consecutive nucleotides, wherein the Thysanoptera insect pest ingests double-stranded RNA comprising at least one strand complementary to the polynucleotide sequence, and inhibits the growth of the Thysanoptera insect pest.

Description

technical field [0001] The invention relates to a polynucleotide sequence composition for controlling pests, relates to the field of planting technology, in particular to the field of insect resistance, in particular to a method of using RNAi technology to down-regulate or hinder the expression of target sequences in Western flower thrips to inhibit Western flower thrips. Methods of thrips infestation of flowers. Background technique [0002] For the pest disasters in agricultural production, researchers have successfully developed some methods and compositions. Among them, chemical pesticides are one of the effective means to prevent and control pests, but the use of chemical pesticides is a double-edged sword, and the following problems can be accompanied when good results are obtained: 1) chemical pesticides do not have Target selectivity, the application of chemical insecticides to control pest insects can also cause damage to non-target organisms, including beneficial ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113A01N57/16A01P7/04
CPCA01N57/16C12N15/113C12N2310/14
Inventor 董秋月
Owner 杭州昆成生物科技有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com