Application of a cotton GhLecRK1 gene in plant greensickness resistance
An anti-Verticillium wilt, gene technology, applied in the fields of application, plant products, genetic engineering, etc., can solve the problem of unseen LecRK gene function, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
experiment example 1
[0023] Experimental example 1: Cloning and bioinformatics identification of cotton GhLecRK1 gene
[0024] 1. Cloning of GhLecRK1 gene in upland cotton
[0025] ① Extract the total RNA of upland cotton TM-1 variety according to the extraction steps in the manual of Aidlab's EASYspin Plus Plant RNA Rapid Extraction Kit and reverse transcribe it into cDNA, dilute the cDNA concentration to 50-60ng / μL. Seeds of upland cotton TM-1 were provided by the Cotton Research Institute of the Chinese Academy of Agricultural Sciences.
[0026] ②In the upland cotton genome database released by Nanjing Agricultural University (http: / / mascotton.njau.edu.cn / ), the L-type LecRK family genes were identified and expressed in the upland cotton transcriptome data. The L-type LecRK family gene whose expression level is higher in the root is numbered Gh_A09G2414, which is named GhLecRK1 in the present invention. According to the GhLecRK1 gene sequence, a pair of amplification primers are designed with ...
experiment example 2
[0037] Experimental Example 2: Analysis of the promoter sequence of GhLecRK1
[0038] The upstream 2kb sequence of GhLecRK1 was extracted from the upland cotton genome database, and the online website Plant CARE was used to predict its cis-acting elements. It was found that the upstream of the transcription start site of its promoter segment contains many cis-acting elements that respond to pathogenic bacteria and adversity stress. Such as: TC-rich repeats, the element plays an important role in responding to stress resistance and disease resistance; AREmotif responds to and regulates hypoxic or anaerobic conditions; there is also the element Box-W1 responding to fungi; cismotif responding to elicitors formula element EL1-box1. In addition, the promoter region of the gene also contains many stress-related elements that respond to hormones and light. It shows that GhLecRK1 may be involved in the regulation of various organisms, abiotics and hormones.
experiment example 3
[0039] Experimental example 3: GhLecRK1 subcellular localization
[0040] ①GhLecRK1 is located in the plasma membrane according to the prediction of subcellular localization by PSORT online software; GhLecRK1 protein has a transmembrane domain predicted by TMHMM Server v.2.0 online software.
[0041] ② Subcellular localization of GFP fusion expression
[0042] Design primers for PCR amplification of the GhLecRK1 sequence, the primers are:
[0043] F: GGGGACAAGTTTTGTACAAAAAAGCAGGCTCAATGGCTTTCCTTCTCTTCTGGTTTTATCTTC
[0044] R: GGGGACCACTTTGTACAAGAAAGCTGGGTGTCTGCCGCTGCTCATGGAACTG.
[0045] The obtained GhLecRK1 sequence was connected into the subcellular localization vector pK7FWG2.0 to construct the GhLecRK1::GFP fusion expression vector. In order to avoid affecting the transmembrane transfer of the N-terminal signal peptide guiding protein, the GFP in the vector is the C of the GhLecRK1 fragment. end connection. Using 35S-GFP as a positive control, transiently transform tob...
PUM
Property | Measurement | Unit |
---|---|---|
Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com