Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for rapid detection of components of Iphigenia indica and Fritillaria maximowiczii

A technology of Fritillaria verticillum and Fritillaria verticillium, applied in the direction of biochemical equipment and methods, microbe determination/inspection, etc., to achieve the effects of promoting the modernization of traditional Chinese medicine, strengthening management, good sensitivity and specificity

Pending Publication Date: 2018-01-12
SUZHOU PUNI TEST TECH CO LTD
View PDF3 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] At present, there is no rapid and accurate detection method for fritillary fritillary and fritillary fritillaria, which are easy to be adulterated and toxic, and there is an urgent need to develop new methods to quickly and easily detect the components of fritillary fritillary and fritillaria verticillium Technology

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapid detection of components of Iphigenia indica and Fritillaria maximowiczii
  • Method for rapid detection of components of Iphigenia indica and Fritillaria maximowiczii
  • Method for rapid detection of components of Iphigenia indica and Fritillaria maximowiczii

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] 1. Primers and probes used:

[0038] Use the GenBank database (https: / / www.ncbi.nlm.nih.gov / genbank / ) to find the rbcL gene of Iphigenia indica and the ITS2 gene of Fritillaria maximowiczii, and their GenBank Accession numbers are respectively For AJ417893 and KP712000.1, design and synthesize real-time fluorescent PCR specific amplification primers and probes.

[0039] The primers and probes for real-time fluorescent PCR detection of Fritillaria fritillaria-derived components are:

[0040] Upstream primer P1: CCAGTCTTGATCGTTACAAAGG

[0041] Downstream primer P2: GAACCTTCTTCAAAAAGGTCTAAAGG

[0042] The sequence of the probe with fluorescent dye is: AGCATCGAGAAAGTTATTGGGGAAGAAAATCA

[0043] The fluorescent dyes are labeled with FAM at the 5' end and TAMRA at the 3' end.

[0044] The primer probes for real-time fluorescent PCR detection of Fritillaria verticillium components are:

[0045] Upstream primer P1: CTACTCGGGACCTCGCAAT

[0046] Downstream primer P2: CACCGCA...

Embodiment 2

[0075] 1. Primers and probes used:

[0076] The rbcl genes of Fritillaria fritillaria and Fritillaria verticillum were selected as objects, and specific amplification primers and probes for real-time fluorescent PCR were designed and synthesized.

[0077] The primers and probes for real-time fluorescent PCR detection of Fritillaria fritillaria-derived components are:

[0078] Upstream primer P1: CCAGTCTTGATCGTTACAAAGG

[0079] Downstream primer P2: GAACCTTCTTCAAAAAGGTCTAAAGG

[0080] The sequence of the probe with fluorescent dye is: AGCATCGAGAAAGTTATTGGGGAAGAAAATCA

[0081] The fluorescent dyes are labeled with FAM at the 5' end and TAMRA at the 3' end.

[0082] The primer probes for real-time fluorescent PCR detection of Fritillaria verticillium components are:

[0083] Upstream primer P1: CTACTCGGGACCTCGCAAT

[0084] Downstream primer P2: CACCGCAGAGGCATCGAC

[0085] The sequence of the probe with fluorescent dye is: TCCTCGGACACTATTT.

[0086] The fluorescent dyes are...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for rapid detection of the components of Iphigenia indica and Fritillaria maximowiczii. The invention relates to primers, probes and the specific detection method for real-time fluorescent PCR detection of the components of Iphigenia indica and Fritillaria maximowiczii. The primers, probes and method have good sensitivity and specificity, can be used for identification of the components of Iphigenia indica and Fritillaria maximowiczii, and are of great significance to reinforcement of the quality management of traditional Chinese medicines and to modern development of traditional Chinese medicines.

Description

Technical field: [0001] The invention belongs to the technical field of biological detection, and relates to a detection method of traditional Chinese medicine components, in particular to a primer, a probe and a detection method for detecting the components of fritillary fritillaria and fritillaria verticillum. Background technique [0002] Fritillaria is a perennial herb whose bulbs are used for medicinal purposes. It is named for its shape. "Compendium of Materia Medica" says: "It looks like a shellfish", hence the name Fritillaria. Fritillaria cirrhosa (Fritillaria cirrhosa) is a treasure among Fritillaria, and it is the underground bulb of Fritillaria cirrhosa, Fritillaria cirrhosa, Fritillaria Roche, Fritillaria cirrhosa, Fritillaria cirrhosa, etc., which are perennial herbaceous plants of the Liliaceae family. It gets its name because it is mainly produced in Sichuan, but it is also produced in Tibet, Gansu, Xinjiang, North China, and Northeast China. Chuanbei has a ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6895C12Q1/686
CPCY02A50/30
Inventor 宋薇张斌崔山闫涛郭文宗
Owner SUZHOU PUNI TEST TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com