Tobacco nicotine content regulation gene NtCLC-b as well as cloning method and application of gene
A technology for regulating genes and cloning methods, applied in the field of genetic engineering, can solve problems such as affecting nicotine content
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Example 1: Cloning NtCLC-b Gene
[0040] Tobacco leaf cDNA was used as a template, and primers were designed according to the tobacco genome database information, and the NtCLC-b PCR amplification of the gene to obtain the PCR amplification product. Design primers as follows:
[0041] Forward primer: 5'- ATGGAGGAGCCAACTCGATTAGTAG -3';
[0042]Reverse primer: 5'-TCAGTTCCCCTTTTTACCGCTTTTTG-3'.
[0043] The PCR reaction system and amplification conditions are shown in Table 1.
[0044] Table 1 PCR reaction system and conditions
[0045]
[0046] The amplified PCR product was electrophoresed on a 0.8% agarose gel, and the gel electrophoresis results were as follows: figure 1 shown. After electrophoresis, the PCR product purification kit from Qiagen was used to recover and purify the PCR product according to the product instructions, and sent to Invitrogen for sequencing to verify the sequence results.
Embodiment 2
[0047] Embodiment 2: plant transformation vector construction
[0048] In Example 1 NtCLC-b The full-length fragment was used as a template, and the primers containing the Gateway adapter sequence were used for PCR amplification. After the PCR product was purified, the amplified product was inserted into the pdonr-zeo vector of Invitrogen Company through BP reaction. The constructed BP reaction carrier will be converted to NtCLC-b The fragment was replaced into the PB2GW7 overexpression vector. Specific steps are as follows:
[0049] (1) According to the selected tobacco genome NtCLC-b Primers were designed according to the gene sequence, and according to the BP reaction requirements in the Gateway system, a 5'-GGGACAAGTTTGTACAAAAAAGCAGGCTGC-3' sequence was added before the forward primer, and a 5'-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3' sequence was added before the reverse primer. Get the Gateway reaction primer sequence as follows:
[0050] NtCLC-b_F:
[0051] 5'-GGGGACAAGT...
Embodiment 3
[0071] Example 3: Agrobacterium-mediated tobacco transformation and identification of transgenic plants
[0072] (1) Transformation of Agrobacterium by freeze-thaw method
[0073] Add 1 μg (200 ng / μL) of PB2GW7 recombinant vector to 100 μL of competent Agrobacterium LBA4404, mix well, let stand on ice for 5 min, freeze in liquid nitrogen for 5 min, and then take it out from the liquid nitrogen. Place in a water bath at 37°C for 5 minutes, then let stand on ice for 5 minutes, add 500 μL LB solution, resume cultivation at 28°C for 4 hours under sufficient shaking conditions, and finally spread the bacterial solution evenly on the selective plate culture medium at 28°C for 48 h.
[0074] (2) Tobacco variety K326 was transformed by leaf disk method.
[0075] The specific method is as follows:
[0076] (a) Under aseptic conditions, put the tobacco K326 seeds into the EP tube and wash them with sterile water for 2-3 times;
[0077] (b) Soak in 75% alcohol for 30-60 s;
[0078] ...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap