Positive reference taking GG type of 1510 site of human ALDH2*2 gene as template
A reference product, gene technology, applied in the field of molecular biology, to achieve the effect of solving the problem of quality inspection
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment
[0020] Example: A positive reference product using the GG type at site 1510 of the human ALDH2*2 gene as a template
[0021] The GG type positive reference product is a reagent with a base sequence as the main component. The base sequence contains the human ALDH2*2 gene fragment, and the human ALDH2*2 gene fragment is 5'-GAGCCCAGTCACCCCTTTGGTGGCTACAAGATGTCGGGGAGTGGCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACT G AAGTGAAAACTGTGAGTGTGGGACCTGCTGGGGGCTCAGGGCCTGTTGGGGCTTGAGGGCTGCTGGTGGCTCGGAGCCT-3' (as shown in SEQ NO: 4), wherein the base site with the underline is the 1510 site of the human ALDH2*2 gene, and the 1510 site is used to characterize the GG of the human ALDH2*2 gene The position where type AA can be mutated into type AA of the human ALDH2*2 gene. The GG-type positive reference product also contains a buffer reagent, which is a Tris-HCl buffer solution with a pH of 7.6.
[0022] Type AA positive reference substance is a reagent with a base sequence as the main component. The b...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap