Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Positive reference product using human ADBR1 gene 1165 site CC type as template

A reference product, gene technology, applied in the field of molecular biology, to achieve the effect of solving the problem of quality inspection

Inactive Publication Date: 2019-06-25
踏石生物科技(苏州)有限公司
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to provide a positive reference product with CC type 1165 of human ADBR1 gene as a template, which is used to verify whether the detection result of CC type 1165 of human ADBR1 gene in the tested sample is accurate, and solves the problem of human Quality testing problems of ADBR1 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Positive reference product using human ADBR1 gene 1165 site CC type as template
  • Positive reference product using human ADBR1 gene 1165 site CC type as template
  • Positive reference product using human ADBR1 gene 1165 site CC type as template

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0020] Embodiment: A kind of positive reference product with CC type 1165 of human ADBR1 gene as template

[0021] The GG type positive reference product is a reagent with a base sequence as the main component. The base sequence contains a human ADBR1 gene fragment, and the human ADBR1 gene fragment is 5'-GGCGGGCCCTCGCGCCTCGTGGCCCTGCGCGAGCAGAAGGCGCTCAGGACGCTGGGCATCATCATGGGCGTCTTCACGCT G TGCTGGCTGCCCTTCTTCCTGGCCAACGTGGTGAAGGCCTTCCACCGCGAGCTGGTGCCCGACCGCCTCTTCGTCTTCT-3' (as shown in SEQ NO: 4), wherein the underlined base site is the 1165 site of the human ADBR1 gene, and the 1165 site is used to characterize that the GG type of the human ADBR1 gene can be mutated into a human Location of the CC type of the ADBR1 gene. The GG-type positive reference product also contains a buffer reagent, which is selected from Tris-HCl buffer solution with pH 7.6.

[0022] CC-type positive reference product is a reagent with a base sequence as the main component. The base sequence contains a h...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

A positive reference product using the human ADBR1 gene 1165 site CC type as a template is characterized in that the positive reference product is a reagent taking a base sequence as a main component.The base sequence comprises a human ADBR1 gene fragment, and the human ADBR1 gene fragment is shown in SEQ NO: 5, wherein an underlined base site is an 1165 site of the human ADBR1 gene, and the 1165site is used to characterize the location of the CC type of the human ADBR1 gene capable of being mutated to the GG type of the human ADBR1 gene. The positive reference product is used for verifyingwhether a test sample contains the human ADBR1 gene 1165 site CC type and whether the detection result is accurate, and the problem of quality detection of the human ADBR1 gene is solved.

Description

technical field [0001] The invention relates to the technical field of molecular biology, in particular to a positive reference product using the CC type at 1165 of the human ADBR1 gene as a template, and the positive reference product is used to verify whether the ADBR1 genotype detection kit is used for sample detection. Auxiliary judgment for positive. Background technique [0002] Quality control substances refer to quality control substances used in in vitro diagnostics, which have target detection substances with known concentrations, and are necessary products to make people believe that the quality of a certain product or service can meet the specified quality requirements. The purpose of quality control is to verify the accuracy, effectiveness and specificity of the entire PCR reaction process, and to monitor the status of the detection system. After the instrument is officially put into use, it should be calibrated regularly to avoid experimental deviations caused...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6876C12N15/11
Inventor 孙茜
Owner 踏石生物科技(苏州)有限公司
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More