Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting fungaltoxin through multiple signals and kit

A mycotoxin and multi-signal technology, applied in biological testing, measuring devices, material inspection products, etc., can solve the problems of complex operation, non-target signal amplification, and targeted signal quenching, and achieve simple operation and abundant mycotoxins Recognition method and signal conversion and amplification mode, the effect of improving accuracy

Active Publication Date: 2017-10-20
ACAD OF NAT FOOD & STRATEGIC RESERVES ADMINISTRATION
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the detection of aptamer biosensors is mostly combined with bio-nanomaterials, which requires synthesis steps or labeling and modification of signal molecules in the early stage. Non-specific adsorption of objects, resulting in quenching of targeted signals or amplification of non-targeted signals

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting fungaltoxin through multiple signals and kit
  • Method for detecting fungaltoxin through multiple signals and kit
  • Method for detecting fungaltoxin through multiple signals and kit

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0062] Example 1 A method for multi-signal detection of ochratoxin A (OTA)

[0063] A kind of method for multi-signal detection OTA, concrete operation step process is as follows (concrete steps are as follows figure 1 shown):

[0064] The OTA nucleic acid aptamer (5'-GATCGG GTGTGGGTGGCGTAAAGGGAGCATCGGACA -PO 4 3- -3') and 1 μM phosphorylated aptamer complementary sequence (5'- TGTCCGATGCTCCCTTTACGCCACCCACAC -PO 4 3- -3') and 0-200ppb OTA were reacted in Tris-HCl buffer (20mM Tris-HCl, pH 7.5) for 2min.

[0065] Add the above solution and 8 units of Hpy188I to the reaction buffer (20mM Tris-Ac, 10mM Mg(Ac) 2 , 50mM KAc, pH 7.9) for 60min, then the solution was heated to 65°C and kept for 20min to terminate the reaction.

[0066] Add 5 units of TdT and 1mM dNTPs (dGTP 50%, dATP 40%, dTTP 10%) to the above solution, in the reaction buffer (1M potassium cacodylate, 125mM Tris, 0.05% Triton X-100, 5mM CoCl 2 ,pH 7.2) at 37°C for 2h, then stop the reaction in a 70°C wate...

Embodiment 2

[0071] Embodiment 2 A kind of kit for multi-signal detection OTA

[0072] A kit for multi-signal detection OTA, comprising:

[0073] OTA nucleic acid aptamer, aptamer complementary sequence, enzyme digestion auxiliary signal amplification system, G4 structure preparation system, colorimetric, fluorescent and chemiluminescent detection system.

[0074] The OTA nucleic acid aptamer after phosphorylation and blocking treatment is 5′-GATCGG GTGTGGGTGGCGTAAAGGGAGCATCGGACA -PO 4 3- -3'.

[0075] The complementary sequence of the aptamer after phosphorylation and blocking treatment is 5′- TGTCCGATGCTCCCTTTACGCCACCCACAC -PO 4 3- -3'.

[0076] Enzyme-assisted signal amplification system includes Hpy188I and reaction buffer (20mM Tris-Ac, 10mM Mg(Ac) 2 , 50mM KAc, pH 7.9).

[0077] The G4 structure preparation system includes TdT, dNTPs (GTP 50%, dATP 40%, dTTP 10%), reaction buffer (1M potassium cacodylate, 125mM Tris, 0.05% Triton X-100, 5mM CoCl 2 , pH 7.2).

[0078] Col...

Embodiment 3

[0081] Example 3 A method for multi-signal detection of zearalenone (ZEN)

[0082] A method for multi-signal detection ZEN, the specific operation steps are as follows:

[0083] The ZEN aptamer (5'-GCATCACTACAGTCATTACGCATCGTGGGGATGGGAGGTTGTGTGGGGGATGGGAGGTTGT TACGCAGGAGATGTTAATCGTGTGAAGTGC -PO 4 3- -3') and 100nM phosphorylated aptamer complementary sequence (5'- GCACTTCACACGATTAACATCTCCTGCGTA -PO 4 3- -3') and 0-500ppb ZEN were reacted in Tris-HCl buffer (20mM Tris-HCl, pH 7.5) for 5min.

[0084] Add the above solution and 2 units of MseI to the reaction buffer (20mM Tris-Ac, 10mM Mg(Ac) 2 , 50mM KAc, pH 7.9) for 45min, then the solution was heated to 65°C and kept for 20min to terminate the reaction.

[0085] Add 2 units of TdT and 1mM dNTPs (dGTP 60%, dATP 40%,) to the above solution, in reaction buffer (1M potassium cacodylate, 125mM Tris, 0.05% Triton X-100, 5mM CoCl 2 ,pH 7.2), incubate at 37°C for 60min, then stop the reaction in a water bath at 70°C for 10min...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for detecting fungaltoxin through multiple signals. The method comprises the following steps: 1) combining fungaltoxin with aptamer: adding a to-be-detected sample after the reaction of the fungaltoxin aptamer and complementary sequence thereof, thereby acquiring a mixed solution A; 2) amplifying a digestion auxiliary signal: reacting the mixed solution A with restriction enzyme, thereby acquiring a mixed solution B; 3) preparing a guanine tetramer structure: reacting the mixed solution B with tail-end deoxynucleotide transferase and deoxyribonucleoside triphosphate and reacting with ligand molecules, thereby acquiring a mixed solution C; and 4) detecting and analyzing: performing catalytic oxidation reaction on the mixed solution C and different substrates, generating ultraviolet, fluorescent and chemiluminescent signals and calculating the content of fungaltoxin in the to-be-detected sample according to the relation of the response strength of all the signals and the fungaltoxin concentration. The method disclosed by the invention has the characteristics of quick and simple operation and treatment, short detection time, marker-free effect, low cost, high precision, high sensitivity, and the like.

Description

technical field [0001] The invention relates to the technical field of biosensing analysis and food and feed safety detection. More specifically, it relates to a method and a kit for multi-signal detection of mycotoxins. Background technique [0002] Many foods and feeds are susceptible to fungal contamination during production, storage, processing and distribution, producing toxic secondary metabolites mycotoxins. According to the estimates of the Food and Agriculture Organization of the United Nations, about 1 / 4 of the food in the world loses its nutritional and economic value due to mycotoxin contamination every year. The more common types of mycotoxins include ochratoxin, zearalenone, deoxynivalenol, and T-2 Toxins, aflatoxins, and fumonisins, etc., some of which have been proven to have the "three causes" of carcinogenicity, teratogenicity, and mutagenicity. China (GB 2761-2017) and other parts of the world have generally established limits for mycotoxins, clarifying ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): G01N33/569G01N33/566G01N33/52
CPCG01N33/52G01N33/566G01N33/56961G01N2333/37
Inventor 韩逸陶张晓琳刘玉春汪洋赵晨张宏海
Owner ACAD OF NAT FOOD & STRATEGIC RESERVES ADMINISTRATION
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com