High-flux screening method for novel broad-spectrum lysozyme
A lysozyme and broad-spectrum technology, applied in the field of molecular biology, to achieve high-throughput detection and improve sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0053] Example 1: Construction of tussah silkworm lysozyme gene mutation library
[0054] Tussah silkworm is an economic insect in northern China. Tussah silkworm lysozyme (Aplyz) has the characteristics of wide temperature range and low optimum temperature, and has good application value. The tussah silkworm lysozyme gene sequence was found from the NCBI database. The mature peptide sequence is 363bp in total. The company carried out the whole gene synthesis. The synthesized gene sequence is as follows:
[0055] AAGTGGTTTACCAAATGTGGTCTAGTGCACGAGCTGAGGAGACAAGGCTTCGACGAGAGCCTAATGAGAGACTGGGTCTGTTTGGTTGAGAACGAAAGCAGCAGATATACTAATAAAATCGGTAAAGTGAATAAGAATGGTTCTCAAGACTACGGTTTGTTCCAGATCAATGACAAATATTGGTGTAGTAAGACCTCCACCCCCGGAAAGGATTGCAATGTGACTTGTAATCAATTGTTGACTGACGATATTACAGTTGCTGCTACCTGTGCGAAGAAGATTTACAAGAGACATAAGTTTAACGCTTGGTACGGATGGTTAAACCACTGTCAACACTCTCTTCCAGACATTAGCGACTGTTAA;
[0056] According to the expression vector pPICZαA to be connected and the above-mentioned tussah silkworm...
Embodiment 2
[0082] Example 2: Transferring recombinant expression plasmids into Pichia pastoris cells
[0083] Pichia pastoris expression system is a good eukaryotic expression system, combined with pPICZαA expression plasmid can achieve good extracellular expression.
[0084] The specific operation steps for the preparation of Pichia pastoris competent cells are as follows:
[0085] (1) Pick a single clone of Pichia pastoris GS115 on the YPDS plate and inoculate it in 10 ml of YPD liquid medium. To ensure ventilation, seal it with 6 layers of gauze and culture overnight at 30°C and 250rpm.
[0086] (2) Transfer to a 250ml Erlenmeyer flask with baffles containing 50ml YPD liquid medium according to the inoculum size of 1%. 30°C, 250rpm shaking culture for about 20h to OD 600 It is 1.3-1.5.
[0087] (3) Transfer the bacterial solution into a pre-cooled 50ml centrifuge tube, place in an ice bath for at least 30 minutes to fully cool the cells, and collect the cells by centrifugation at 4...
Embodiment 3
[0100] Example 3: Construction of Escherichia coli expressing "cyan fluorescent protein-TEV protease recognition site-yellow fluorescent protein" in the cell
[0101] Escherichia coli is a typical Gram-negative bacterium, which is convenient to obtain, easy to operate and cultivate, and has a lipopolysaccharide outer membrane on the cell wall, so lysozyme has a poor cleavage effect on it.
[0102] According to the fluorescent protein gene and TEV protease recognition site gene sequences found in the NCBI database, the "cyan fluorescent protein-TEV protease recognition site-yellow fluorescent protein" gene was synthesized with XhoI and NocI restriction sites at both ends. sequence. The cloning plasmid and expression plasmid pET28a containing the protein pair gene were double-digested with two restriction endonucleases, and the desired fragment was recovered by electrophoresis. Prepare the connection system, connect the fluorescent protein pair gene and the expression plasmid p...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap