Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Molecular marker of rice grain width gene GW2 and application of molecular marker

A molecular marker and rice technology, applied in the field of plant biology, can solve the problems of limited detection throughput, high experimental cost, cumbersome operation process, etc., and achieve the effect of high detection throughput, low cost and strong specificity

Active Publication Date: 2017-08-18
HAINAN BOLIAN RICE GENE TECH CO LTD
View PDF4 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, this marker needs to be digested after PCR, the operation process is relatively cumbersome, the experimental cost is relatively high, and the detection throughput is also limited.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker of rice grain width gene GW2 and application of molecular marker
  • Molecular marker of rice grain width gene GW2 and application of molecular marker
  • Molecular marker of rice grain width gene GW2 and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1 Primer Design and Amplified Fragment Analysis of Rice GW2 Gene Molecular Marker

[0037] 1. Primer design

[0038] Through the sequence comparison of the alleles of rice grain wide gene GW2 in wide-grained and narrow-grained varieties, a functional single base deletion in the fourth exon of GW2 coding region was obtained in wide-grained and narrow-grained varieties. Design the primer combination according to the sequence upstream and downstream of the base site:

[0039] GW2-F1: CACAATGTCCATTCTGCCAACT (SEQ ID NO. 1),

[0040] GW2-F2:AGCCTACACAATGTCGATTCTGCAAAAC (SEQ ID NO. 2),

[0041] and GW2-R: TGTTCTATGCTCCTTTCCTCCTTTG (SEQ ID NO.3) (see the schematic diagram of primer design figure 1 ).

[0042] 2. Analysis of amplified fragments

[0043] When the above primer combination is used to amplify the rice grain wide gene GW2, only one 88bp band will be amplified from the narrow-grain material, and only one 81bp band will be amplified from the wide-grain mat...

Embodiment 2

[0044] Embodiment 2 Identify the GW2 genotype of the rice variety / line with the molecular marker of the present invention

[0045] 1. Measuring method of rice grain width: randomly select 3 plants for each variety / line, select 10 full grains for each plant and connect the back and abdomen to measure the average grain width to represent the grain width of each plant, and the average grain width of the 3 plants represents the variety / Strain grain width.

[0046] 2. Measuring method of rice grain weight: randomly select 3 plants for each variety / line, select 100 plump seeds from each plant to measure the 100-grain weight, and the average value of the 100-grain weight of the 3 plants represents the grain weight of the variety / line.

[0047] 3. Extraction of rice genomic DNA

[0048] Twelve rice varieties / lines including N411, Wufeng B, Huazhan, Zhongxianghuangzhan, R51084, Qingfeng 1B, Nan H197, Fufenghui 1658, Yuanfeng 9918S, 9311, Yue 4B, H28B were used as materials , using t...

Embodiment 3

[0058] Embodiment 3 Application of molecular markers of the present invention

[0059] 1. Rice material F of rice variety N411 and Ng Fung B 2 Generation of 16 individual plants.

[0060] 2. Extraction of Genomic DNA of Rice Genomic DNA of leaves was extracted at the seedling stage, and the specific method was the same as in Example 2.

[0061] 3. Refer to Example 2 for PCR amplification and product judgment criteria.

[0062] 4. Refer to Example 2 for the rice grain width and grain weight measurement method.

[0063] 5. Result and analysis Use the molecular marker of Example 1 of the present invention (specific primer combination GW2-F1, GW2-F2, GW2-R obtains by PCR amplification) to detect 16 F of N411 and Wufeng B at the seedling stage 2 For the genotype of GW2 in a single plant, it was found that 8 single plants only amplified 88bp bands, 2 single plants only amplified 81bp bands, and 6 single plants amplified both 88bp and 81bp bands strip (see image 3 ). pair hete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a molecular marker of a rice grain width gene GW2 and an application and belongs to the technical field of plant biology. The molecular marker is obtained through PCR amplification of two forward primers and a reverse primer, wherein nucleotide sequences of the primers are as shown in SEQ ID NO.1-3 separately. By using the molecular marker of the rice grain width gene GW2, genetic typing of GW2 can be completed only through simple PCR, and the rice grain width variation is predicted. The molecular marker has the advantages of being simple in operation, fast in typing, accurate in result and low in cost, is capable of improving the character selection efficiency, and meets the requirements of large-scale molecular marker-assisted selection.

Description

technical field [0001] The invention belongs to the field of plant biotechnology, and in particular relates to a molecular marker of rice grain width gene GW2 and its application. Background technique [0002] my country is the most important rice production and consumption country. In the past few decades, rice production has doubled, and the research on rice production-related genes has also made great breakthroughs, including qGL3, GW2, qSW5 / GW5, GS3, GS5, GW8 Isogenes were cloned successively. The yield of rice mainly depends on the number of panicles, the number of grains per panicle and grain weight, while the grain weight is mainly determined by the three basic characters of grain shape: length, width and thickness. Among the three factors constituting rice yield, the genetics of grain weight (usually represented by thousand grain weight) is relatively stable. At the same time, because grain weight has a close relationship with the appearance quality and cooking and e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor 黄培劲龙湍李佳林唐杰刘昊李新鹏张维安保光曾翔吴永忠
Owner HAINAN BOLIAN RICE GENE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com