Transient expression vector carrying NtRBSC1 gene
A transient expression and gene technology, applied in genetic engineering, using vectors to introduce foreign genetic material, recombinant DNA technology, etc., can solve the problems of lack of research on positioning and its mechanism of action
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0046] The transient expression vector carrying NtRBSC1 gene provided by this application, which carries NtRBSC1 (Ntab0062040)) and a gene of fluorescent marker protein GFP (using fluorescent marker protein GFP gene as reporter gene), its preparation method is described in detail as follows.
[0047] (1) PCR amplification to obtain the NtRBSC1 gene, specifically:
[0048] The total RNA (RIN ≥ 7.5) was extracted from Honghua Dajinyuan tobacco variety, and cDNA was further reverse-transcribed. Using this as a template, the NtRBSC1-F / NtRBSC1-R primer pair was designed for PCR amplification. The amplified product of the NtRBSC1 gene was obtained and recovered.
[0049]The NtRBSC1-F / NtRBSC1-R primer pair is designed using DNAMAN6.0 in combination with the NtRBSC1 gene sequence. The base sequence of the NtRBSC1 gene is shown in SEQ ID NO: 1; the specific sequence of the designed primers is:
[0050] NtRBSC1-F: CGGGGTACCATGTCTGTCTCAAGTT, wherein the partial sequence of GGTACC is the...
Embodiment 2
[0081] The NtRBSC1-pFF19-GFP plasmid vector prepared in Example 1 was transformed into tobacco protoplasts by the PEG-mediated tobacco protoplast transformation method, and further observed by laser confocal microscopy, the tobacco NtRBCS1 can be positioned more intuitively, so as to identify the relevant genes. The research lays the research foundation and application foundation, and the relevant experiments are briefly introduced as follows.
[0082] (1) To prepare tobacco protoplasts, the specific operations are:
[0083] 1. Weigh 0.2g Cellulase R-10 (Solarbio) and 0.08g Macerozyme R-10 (Solarbio), add to 20mL enzyme stock solution, bathe in 55℃ water for 10min, add 200uL of 1M CaCl after cooling 2 (10mM), 0.02g BSA (0.1%), filtered through 0.45μm micropores to make enzymatic hydrolysis solution, transfer it into a 100mL small beaker for later use;
[0084] 2. Take 4-week-old tobacco leaves (Safflower Dajinyuan, healthy and well-growing hypertrophic leaves), transform abou...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com