Supercharge Your Innovation With Domain-Expert AI Agents!

A kind of cellulose synthase pccesa1 protein from Phytophthora capsici and its coding gene and application

A cellulose synthase, coding technology, applied in application, genetic engineering, plant genetic improvement and other directions, can solve problems such as restricting control effect

Active Publication Date: 2019-11-12
CHINA AGRI UNIV
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, Phytophthora capsici is a heterothallic pathogen. When there are two mating types A1 and A2 in the field, the oospores produced by sexual reproduction can survive in the soil for several years. Existing methods severely restrict its research. Anti-effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of cellulose synthase pccesa1 protein from Phytophthora capsici and its coding gene and application
  • A kind of cellulose synthase pccesa1 protein from Phytophthora capsici and its coding gene and application
  • A kind of cellulose synthase pccesa1 protein from Phytophthora capsici and its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0072] Example 1. Acquisition of cellulose synthase pccesa1 gene and analysis of its expression at the RNA level

[0073] 1. Acquisition of cellulose synthase pccesa1 gene

[0074] 1. Using the genomic DNA of Phytophthora capsici strain Hd11 as a template, cDNA was obtained by reverse transcription;

[0075] 2. Using the cDNA of Phytophthora capsici strain Hd11 as a template, the following primers were used for PCR amplification: forward primer: ACCCCGGATTCTAGAACTAGTGGATCCCCCATGTTCAACAAGGATCAACCAG and reverse primer: AAATTGACCTTGAAAATATAAATTTTCCCCCGCCCTCCACAGGCTTC to obtain PCR amplification products. and sequence it.

[0076] Sequencing results showed that: PCR amplification obtained a PCR amplification product with a size of 3048bp, and its deoxyribonucleotide sequence was shown in sequence 1 in the sequence table, and the gene shown in sequence 1 was named pccesa1, wherein, from the 5' end ORFs 1-3048 encode a protein consisting of 1015 amino acid residues, the protein is...

Embodiment 2

[0102] Example 2, Heterologous expression and biochemical function analysis of Phytophthora capsici PCCESA1 protein

[0103] 1. Heterologous expression and purification of PCCESA1 protein

[0104] 1. Heterologous expression of PCCESA1 protein

[0105] The pccesa1 gene shown in Sequence 1 in the Sequence Listing was connected into pDDGFP-2 (GFP-8 His-containing vector) by homologous recombination to obtain an expression vector. The specific steps are as follows: linearize the pDDGFP-2 (GFP-8His-containing vector) vector with SmaI endonuclease to obtain the linearized vector; -1 Linearized vector, 5 μL 150ng μL -1 The PCR amplified product obtained in step 1 of Example 1 (the sequence of the PCR amplified product is shown in sequence 3, the 5' and 3' most end sequences of the amplified product are respectively the same as the sequences at the two ends of the linearized vector identical) and 42 μL μL ddH 2 O mixed to obtain 50 μL DNA mix system. 50 μL of DNA mix was transfer...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
concentrationaaaaaaaaaa
Login to View More

Abstract

The invention discloses a cellulose synthase PCCESA1 protein from phytophthora capsici, and an encoding gene and application thereof. The PCCESA1 protein provided by the invention is the protein as shown in a sequence 2; the encoding gene of the protein is as shown in a sequence 1. An experiment proves that the protein PCCESA1 provided by the invention can catalyze substrate uridine diphosphate D glucose (UDPG) to generate cellobiose, and has significance on biosynthesis of main component cellulose of a cell wall of the phytophthora capsici; as an oomycetes cell wall plays an important role in maintaining oomycetes vital movement, including maintaining cell shapes, participating in host interaction and the like. Therefore, the cellulose synthase PCCESA1 protein provided by the invention provides technical support for the oomycetes cell wall, and provides a new molecular target for future bactericide research and development.

Description

technical field [0001] The invention belongs to the field of biotechnology, and specifically relates to a cellulose synthase protein and its application, in particular to the cellulose synthase protein PCCESA1 from Phytophthora capsici and its application. Background technique [0002] Phytophthora capsici belongs to the genus Phytophthora of the family Pythium oomycetae. It has the characteristics of outbreaks and epidemics. It is distributed worldwide and has a wide range of hosts. After infecting hosts, it will cause serious damage and cause serious economic losses. At present, scholars have classified it as one of the top ten important pathogenic oomycetes. At present, it is recommended to use fungicides in combination with other agricultural measures, such as crop rotation, for the prevention and control of diseases caused by Phytophthora capsici. However, Phytophthora capsici is a heterothallic pathogen. When there are two mating types A1 and A2 in the field, the oosp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/10C12N15/54C12P19/08C12P19/18G01N33/68C12Q1/6895
CPCC12N9/1059C12P19/08C12P19/18C12Q1/6895C12Q2600/136C12Y204/01012G01N33/68G01N2333/91114
Inventor 刘西莉庞智黎苗建强刘鹏飞张灿黄中乔王为镇
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More