Supercharge Your Innovation With Domain-Expert AI Agents!

Kit for PRRSV (porcine reproductive and respiratory syndrome virus) serology differential diagnosis

A technique for differential diagnosis of respiratory syndrome, applied in the field of porcine reproductive and respiratory syndrome virus (PRRSV) serological differential diagnosis kit, can solve problems such as not seen

Active Publication Date: 2017-05-10
INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is currently no report on a serological differential diagnosis kit that can simultaneously distinguish European PRRSV, American PRRSV, and HP-PRRSV

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for PRRSV (porcine reproductive and respiratory syndrome virus) serology differential diagnosis
  • Kit for PRRSV (porcine reproductive and respiratory syndrome virus) serology differential diagnosis
  • Kit for PRRSV (porcine reproductive and respiratory syndrome virus) serology differential diagnosis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Select the conserved antigenic epitopes for the N protein of American and European PRRSV ( 50 PEKPHFPLATED DVRHHFTPS 70 ) and the conserved epitope against GP5 ( 195 TRVSAEQWGRL 200 ), the selected epitope ( 50 PEKPHFPLATED DVRHHFTPS 70 with 195 TRVSAEQWGRL 200) nucleotide sequences were concatenated and optimized according to the requirements of prokaryotic expression conditions. The optimized sequence was GGATCCCCGGAGAAGCCGCATTTCCCGCTGGCGACTGAAGATGACGTCCGTCATCACTTTACCCCCGAGTACCCGTGTTTCAGCGGAACAATGGGGTCGTCCTCTGAGCGGCCGC; at the ends (5' and 3') of the optimized sequence were introduced BamHI (GGATCC) and NotI (GCGGCCGC) restriction site (sequence in the box), and a stop codon TGA is introduced before the 3-terminal restriction site. After gene synthesis, the optimized sequence was cloned into the prokaryotic expression vector pET32a. The positive recombinant plasmid pET32a-N-GP5-e was constructed according to the conventional prokaryotic expression method. Afte...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a kit for PRRSV (porcine reproductive and respiratory syndrome virus) serology differential diagnosis. The kit for the PRRSV serology differential diagnosis is mainly used for performing serology differential diagnosis on a classic American-type PRRSV, a European-type PRRSV and a highly pathogenic PRRSV. An envelope antigen of a first ELISA (enzyme linked immunosorbent assay) plate is protein obtained after tandem optimized expression of common antigenic epitopes of the European-type and American-type PRRSVs; an envelope antigen of a second ELISA plate is protein obtained after optimized expression of idiotypic antigenic epitopes of the European-type PRRSV; an envelope antigen of a third ELISA plate is protein obtained after optimized expression of idiotypic antigenic epitopes of the American-type PRRSV; an envelope antigen of a fourth ELISA plate is protein expressed by a nucleotide sequence in an Nsp2 gene deletion region of the highly pathogenic PRRSV. After the detection, the infection type and the antibody level of the PRRSV in porcine serum can be determined. The method is simple and fast and can be effectively applied to the clinical serological diagnosis of different types of PRRSVs.

Description

technical field [0001] The invention belongs to the field of zoonotic diseases, in particular to a porcine reproductive and respiratory syndrome virus (PRRSV) serological differential diagnosis kit. Background technique [0002] Porcine reproductive and respiratory syndrome virus (PRRSV) belongs to the order Reticuloviridae ( Nidovirales ) Arteriviridae ( Arteriviridae ) Arterivirus ( Arterivirus ), which are single-stranded positive-sense RNA viruses. The PRRSV genome is about 15kb long, which are (5' to 3'): non-structural protein ORF1 (ORF1a and ORF1b), structural protein ORF2a (GP2a), ORF2b (GP2b), ORF3 (GP3), ORF4 (GP4), ORF5 (GP5), ORF6 (M) and ORF7 (N). The genome structure of PRRSV is similar to that of other arterivirus genomes, with a cap structure at the 5' end of the virus and polyadenylation at the 3' end. Its non-structural protein ORF1 accounts for about 75% of the total length of the genome, contains enzymes required for PRRSV replication, participates...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): G01N33/569
CPCG01N33/56983G01N2333/08
Inventor 陈如敬吴学敏周伦江陈秋勇车勇良严山王晨燕王隆柏魏宏刘玉涛
Owner INST OF ANIMAL HUSBANDRY & VETERINARY FUJIAN ACADEMY OF AGRI SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More