Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Gene methylation detection method, detection kit and application thereof

A technology for detection kits and detection methods, applied in the direction of DNA / RNA fragments, recombinant DNA technology, etc., can solve the troublesome and complicated analysis of quantitative methods, single-strand detection of gene methylation does not fully consider the overall methylation of the two strands of the gene Level and other issues

Inactive Publication Date: 2017-05-10
JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
View PDF2 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Quantitative analysis is more troublesome and complicated, far less simple than qualitative analysis
Single-strand detection of gene methylation does not fully consider the overall level of methylation of the two strands of the gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene methylation detection method, detection kit and application thereof
  • Gene methylation detection method, detection kit and application thereof
  • Gene methylation detection method, detection kit and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0117] The following will clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only some of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by persons of ordinary skill in the art without making creative efforts belong to the protection scope of the present invention.

[0118] Materials: plasma samples to be tested, methylation-positive DNA at a concentration of 2ng / ul, and methylation-negative DNA at a concentration of 2ng / ul.

[0119] Instruments: Lightcycler 480, rotary mixer, water bath, vortex oscillator, refrigerator.

[0120] Reagents: DNA polymerase (Roche), 10×PCR Buffer (Roche), MgCl 2 (Roche), dNTP (TaKaRa), purified water.

[0121] Primers and probes: The purity of all primers should reach electrophoresis grade (PAGE) or HPLC grade, free of impurities. The reporter fl...

Embodiment 2

[0153] The inventors also performed double-strand detection of HOXA9 gene methylation.

[0154] Probe for sense strand: AAATTACCGACGCCCGCG

[0155] Forward primer for sense strand: TTATTGTTTTGTTGGACGGGTACG

[0156] Reverse primer for sense strand: AATTTCATATAACAACTTAATAACACCG

[0157] Probe for antisense strand: AAACGAACACGTAACGCG

[0158] Forward primer for antisense strand: CGTTCGCGTTTTTATTGGTC

[0159] Reverse primer for antisense strand: CGAACCATTAATAACGTACGAA

[0160] 20 plasma samples from lung cancer and 13 plasma samples from healthy people were tested. HOXA9 gene methylation detection was performed on plasma samples using the above-mentioned double-strand detection method. The internal reference gene ACTB of all plasma samples was amplified and the Cp value was less than 40, which proved that the experiment was accurate and effective. Observing the target gene channel and counting the detection results, the internal reference gene ACTB of all plasma samples was ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene methylation detection method, a detection kit and an application thereof. Gene methylation detection sensitivity is improved by two strands of the same gene for the first time, namely, a positive-sense strand and antisense strand methylation fluorescent accumulating method. Compared with an existing methylation detection technology, the method for detecting gene methylation degrees by the two strands has the advantage of higher gene methylation detection sensitivity. The two strands of DNA (deoxyribonucleic acid) are sufficiently used, fluorescent signal values are increased, methylation fluorescence is double accumulated, the gene methylation detection sensitivity is improved, and the methylation degrees can be distinguished by a qualitative method. Besides, the detection process is reaction in closed pipes with the same hole, namely, methylation of the two strands can be simultaneously detected in one hole, operation is simple and rapid, and the possibility of pollution is decreased. Safety is achieved, the whole system is free from toxic and harmful substances, open pipes of PCR (polymerase chain reaction) products are omitted, and testers and environments are not harmed.

Description

technical field [0001] The invention belongs to the field of biology, in particular to detection of methylation of genes. Background technique [0002] The invention relates to the field of gene detection, in particular to a method capable of improving the detection sensitivity of gene methylation and a kit thereof. DNA methylation is closely related to the occurrence and development of tumors. It is an early event in tumorigenesis. Since the hypermethylation of CPG islands is earlier than tumor proliferation, detection of methylation at certain DNA sites can be used as tumor markers , is a potential indicator for early diagnosis of tumors, disease prediction and efficacy evaluation. DNA methylation analysis usually requires high-temperature sulfur conversion modification of DNA. After high-temperature sulfurization conversion, the double-stranded DNA will dissociate into two non-complementary single strands. At present, in the existing methylation detection technology, t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12N15/11
Inventor 王弢高兵李虹侠
Owner JIANGSU MICRODIAG BIOMEDICINE TECH CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com