Applications of miR-133 micromolecular nucleic acid medicines in preparing medicines for resisting gastric cancer
A technology of 1.mir-133, agomir-133, applied in the field of biomedicine
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0040] The inventor consulted and downloaded the miRNA data of 14 pairs of gastric cancer specimens in the Cancer Genome Atlas (TCGA) database, and analyzed the significantly differentially expressed miRNAs by R language. It was found that miR-133-a-1, miR-133a-2 and miR-133b were significantly down-regulated in gastric cancer tissues compared with normal control samples ( figure 1 A).
[0041] Furthermore, we cultured gastric cancer cell lines SGC7901 and MNK45 in vitro, and used the normal gastric tissue immortalized cell line GES as a control to verify the above results by qRT-PCR. It was found that the expression of miR-133b / a-3p, the mature fragment of miR-133, was significantly down-regulated in gastric cancer cell lines compared with the control cell GES ( figure 1 B).
[0042] In order to further confirm the above experimental results, we collected 20 frozen tissue specimens of clinical gastric cancer (the specimens were from the Second Department of General Surgery ...
Embodiment 2
[0047] Example 2: Effect of high expression of miR-133 on gastric cancer cells in vitro
[0048] Entrust Shanghai Gemma Pharmaceutical Technology Co., Ltd. to synthesize miR-133 mimics (mimics), the sequence is as follows:
[0049] UUUGGUCCCUUCAACCAGCUG (SEQ ID NO. 1)
[0050] or UUUGGUCCCUUCAACCAGCUA (SEQ ID NO. 2).
[0051] experimental method:
[0052] 1. Gastric cancer cell culture and transfection: Gastric cancer cells SGC7901 and MNK45 were purchased from the Cell Bank of the Chinese Academy of Sciences, cultured in DMEM medium containing 10% FBS, and passaged at a ratio of 1:3 every 36 hours. For cell transfection, INTERFERin transfection reagent (purchased from Polyplus-transfection Company) was used to transfect RNA according to the instructions of the reagent.
[0053] 2. Real-time quantitative RT-PCR: total cellular RNA was extracted using TRIzol (Invitrogen), and total mNRA was extracted using a Fast200 kit (purchased from Shanghai Feijie Biotech). qRT-PCR was ...
Embodiment 3
[0055] Example 3: In vivo experiments, high expression of miR-133 can inhibit the growth of gastric cancer.
[0056] experimental method:
[0057] 1. Prepare single-cell suspension from SGC7901 or MNK45 cells, and inject 1×10 6 The cells were inoculated into the right armpit of nude mice by subcutaneous injection to make a tumor-bearing animal model of gastric cancer in nude mice. Nucleic acid drug AgomiR-133 (purchased from Guangzhou Ruibo Company) was injected into the nude mouse tumor-bearing animal model of gastric cancer through tail vein injection.
[0058] 2. Real-time quantitative RT-PCR: total cellular RNA was extracted using TRIzol (Invitrogen), and total mNRA was extracted using a Fast200 kit (purchased from Shanghai Feijie Biotech). qRT-PCR was performed on a LightCycler (Roche) real-time quantitative PCR instrument using the SYBR RT-PCR kit (Takara). The relative quantification of miRNA was calculated using the 2-ΔΔCt method (U6 was an internal reference).
[...
PUM

Abstract
Description
Claims
Application Information

- Generate Ideas
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com