Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Applications of miR-133 micromolecular nucleic acid medicines in preparing medicines for resisting gastric cancer

A technology of 1.mir-133, agomir-133, applied in the field of biomedicine

Inactive Publication Date: 2017-03-01
SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the role of miR-133 in the occurrence and development of gastric cancer, the exact molecular biological mechanism, and whether it can be used as a small molecule nucleic acid drug for clinical treatment of gastric cancer have not been reported yet.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Applications of miR-133 micromolecular nucleic acid medicines in preparing medicines for resisting gastric cancer
  • Applications of miR-133 micromolecular nucleic acid medicines in preparing medicines for resisting gastric cancer
  • Applications of miR-133 micromolecular nucleic acid medicines in preparing medicines for resisting gastric cancer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] The inventor consulted and downloaded the miRNA data of 14 pairs of gastric cancer specimens in the Cancer Genome Atlas (TCGA) database, and analyzed the significantly differentially expressed miRNAs by R language. It was found that miR-133-a-1, miR-133a-2 and miR-133b were significantly down-regulated in gastric cancer tissues compared with normal control samples ( figure 1 A).

[0041] Furthermore, we cultured gastric cancer cell lines SGC7901 and MNK45 in vitro, and used the normal gastric tissue immortalized cell line GES as a control to verify the above results by qRT-PCR. It was found that the expression of miR-133b / a-3p, the mature fragment of miR-133, was significantly down-regulated in gastric cancer cell lines compared with the control cell GES ( figure 1 B).

[0042] In order to further confirm the above experimental results, we collected 20 frozen tissue specimens of clinical gastric cancer (the specimens were from the Second Department of General Surgery ...

Embodiment 2

[0047] Example 2: Effect of high expression of miR-133 on gastric cancer cells in vitro

[0048] Entrust Shanghai Gemma Pharmaceutical Technology Co., Ltd. to synthesize miR-133 mimics (mimics), the sequence is as follows:

[0049] UUUGGUCCCUUCAACCAGCUG (SEQ ID NO. 1)

[0050] or UUUGGUCCCUUCAACCAGCUA (SEQ ID NO. 2).

[0051] experimental method:

[0052] 1. Gastric cancer cell culture and transfection: Gastric cancer cells SGC7901 and MNK45 were purchased from the Cell Bank of the Chinese Academy of Sciences, cultured in DMEM medium containing 10% FBS, and passaged at a ratio of 1:3 every 36 hours. For cell transfection, INTERFERin transfection reagent (purchased from Polyplus-transfection Company) was used to transfect RNA according to the instructions of the reagent.

[0053] 2. Real-time quantitative RT-PCR: total cellular RNA was extracted using TRIzol (Invitrogen), and total mNRA was extracted using a Fast200 kit (purchased from Shanghai Feijie Biotech). qRT-PCR was ...

Embodiment 3

[0055] Example 3: In vivo experiments, high expression of miR-133 can inhibit the growth of gastric cancer.

[0056] experimental method:

[0057] 1. Prepare single-cell suspension from SGC7901 or MNK45 cells, and inject 1×10 6 The cells were inoculated into the right armpit of nude mice by subcutaneous injection to make a tumor-bearing animal model of gastric cancer in nude mice. Nucleic acid drug AgomiR-133 (purchased from Guangzhou Ruibo Company) was injected into the nude mouse tumor-bearing animal model of gastric cancer through tail vein injection.

[0058] 2. Real-time quantitative RT-PCR: total cellular RNA was extracted using TRIzol (Invitrogen), and total mNRA was extracted using a Fast200 kit (purchased from Shanghai Feijie Biotech). qRT-PCR was performed on a LightCycler (Roche) real-time quantitative PCR instrument using the SYBR RT-PCR kit (Takara). The relative quantification of miRNA was calculated using the 2-ΔΔCt method (U6 was an internal reference).

[...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biomedicine, and provides novel medical applications of miRNA miR-133, in particular to the applications of miR-133 in targeted therapy of malignant tumor molecules. The invention further discloses applications of miR-133 in preparing medicines for resisting gastric cancer. The experiment proves that during the generating process of gastric cancer, the expression of miR-133 is obviously inhibited; the recovery of the expression of miR-133 can be realized in the manner that the proliferation of gastric cancer cells is inhibited by targeted anti-apoptosis molecules Mcl-1 and Bcl-xL, so that the anti-tumor effect is achieved. With the adoption of the technical scheme, a novel potential molecular target is provided for the clinical treatment of gastric cancer.

Description

technical field [0001] The invention relates to the technical field of biomedicine, more specifically, the application of miR-133 small molecular nucleic acid medicine in the preparation of anti-gastric cancer medicine. Background technique [0002] Gastric cancer is a common malignant tumor of the digestive system, and it is also a highly malignant tumor. The overall 5-year survival rate is only 20-30%. In my country, its morbidity and mortality both rank second among all malignant tumors. With the standardized development of standard D2 radical surgery for gastric cancer and the application of various new radiotherapy and chemotherapy methods, its clinical efficacy has been improved to a certain extent. However, even after radical resection and standard adjuvant chemotherapy, tumor recurrence and metastasis still occur in some patients, which indicates the limitation of existing treatment methods. At present, gastric cancer is considered to be a tumor with great biologic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): A61K48/00A61K31/713A61P35/00
Inventor 郭猛张鑫蔡清萍刘芳滕飞
Owner SECOND MILITARY MEDICAL UNIV OF THE PEOPLES LIBERATION ARMY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com