Modified entry vector pRMG-C and application thereof
A carrier, prmg-c technology, applied in the direction of carrier, nucleic acid carrier, and the use of carrier to introduce foreign genetic material, etc., can solve the problems of high price and inability to replicate in large quantities, so as to reduce experiment cost, save experiment cost, and save experiment time Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0026] Example 1: Construction of entry vector pRMG-C
[0027] 1. The artificially synthesized sequence is shown as SEQ ID No: 1 multiple cloning site DNA fragment (Shanghai Shenggong Biological Engineering Co., Ltd.), the DNA fragment sequentially contains restriction enzymes SalI, SacI, SphI, BamHI, HindIII , XhoI, PstI, KpnI, EcoRI recognition sequences, the artificially synthesized multiple cloning site basically covers the recognition sites of commonly used restriction enzymes, and the recognition sites of the endonucleases have a specific arrangement sequence, which can facilitate genes Restriction digestion-ligation cloning, while the traditional entry vector pENTR TM / D-TOPO does not contain these restriction enzyme recognition sites.
[0028] Synthetic multiple cloning site DNA fragment (SEQ ID No: 1): 414bp
[0029] TGTAAAACGACGGCCAGTCTTAAGCTCGGGCCCCAAATAATGATTTTATTTTGACTGATAGTGACCTGTTCGTTGCAACAAATTGATGAGCAATGCTTTTTTATAATGCCAACTTTGTACAAAAAAGCAGGCTCCGCGGCCGCCCCCTTCACCAACGAC...
Embodiment 2
[0042] Example 2: Application of the entry vector pRMG-C
[0043] In the present invention, the key gene AhETR1 of the peanut ethylene signal pathway is taken as an example. First, it is subcloned into the entry vector pRMG-C modified by the present invention (in the specific experimental process, you can choose to use restriction enzyme digestion-ligation or use Obtained by cloning technology), and then recombined into overexpression vector pMDC32 (kanamycin resistance), BD vector pLAW10 (kanamycin resistance) and AD vector pLAW11 (ampicillin resistance) for yeast two-hybrid Penicillin resistance). The specific experimental operations are as follows:
[0044] 1) Obtaining the entry clone of peanut AhETR1 gene (take the obligatory cloning technique as an example)
[0045] Using Huayu 31 young leaf cDNA as template, AhETR1-F and AhETR1-R as primers (Table 1, the underlined part is the sequence homologous to the modified entry vector), using high-fidelity enzyme Phusion (Lifetechnolo...
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com