Schistosoma japonicum nucleic acid detection kit based on RPA and detection method
A technology for schistosomiasis nucleic acid and detection kit, which is applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as product pollution to the environment, negative control produces positive results, etc., and achieves the effect of simple and convenient result judgment.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0025] Embodiment 1 template, the preparation of primer and probe
[0026] Genomic DNA extraction: Oncomelania, patient feces, blood, etc., use corresponding nucleic acid extraction methods or genome extraction kits to complete the extraction of genomic DNA. Primer design: Download the nucleic acid sequence from Genebank, select the SjR2 segment of the conservative repeat of Schistosoma japonicum, and design and synthesize RPA primers and probes. RPA reaction primer F1: CCAAGTCTCAGTGAAGTTGTGAAGGCTAT; R1: GTTAGTGTTCGAGACCAGTCAGATGGGATT; RPA reaction probe: CTTAAAGCGAGGGAGAGCGGCAGGACCAGA(dT-FAM)G(THF)A(dT-BHQ1)TGACCCTGAGATAT[3'-block]. The dT near the 5' end (31bp) is labeled with FAM, and the dT near the 3' end (33bp) is labeled with BHQ1. Primers and probes were synthesized by Shanghai Sangong.
Embodiment 2
[0027] Embodiment 2 reaction system and identification method
[0028]Reaction system: add 29.5 μL Rehydration Buffer, 2.1 μL 10 μM PrimerA (RPA reaction primer F1) and 2.1 μL 10 μM PrimerB to RPA freeze-dried particles (phage recombinase UvsX and its cofactor UvsY, DNA polymerase, single-stranded DNA binding protein (gp32), dNTPS) (RPA reaction primer R1), 0.6 μL of 10 μM probe, 10.7 μL of double distilled water, 2.5 μL of template, add 2.5 μL of magnesium acetate on the reaction tube cap, carefully cover the tube cap tightly and centrifuge to mix the magnesium acetate with the solution, and reverse the reaction upside down The tube was thoroughly mixed and then centrifuged again, placed in the TwistDX fluorescence detector, the instrument was automatically heated to 38°C for incubation, and the result could be interpreted by observing the fluorescence curve within 5-20 minutes.
[0029] Result judgment: the fluorescence curve of the reaction tube containing Schistosoma japon...
Embodiment 3
[0030] Embodiment 3RPA primer specificity analysis
[0031] Reaction system: Add 29.5 μL RehydrationBuffer, 2.1 μL 10 μM PrimerA (reaction primer F1: TCTAATGCTATTGGTTTGAGT) to RPA freeze-dried particles (phage recombinase UvsX and its cofactor UvsY, DNA polymerase, single-stranded DNA binding protein (gp32), dNTPS), 2.1 μL 10 μM Primer B (reaction primer R1: TTCCTTATTTTCACAAGGTGA), 0.6 μL 10 μM probe, 10.7 μL double distilled water, 2.5 μL template, add 2.5 μL magnesium acetate on the cap of the reaction tube, carefully close the tube cap and centrifuge to mix the magnesium acetate with the solution, up and down Invert the reaction tube to make it fully mixed and centrifuge again, place it in the TwistDX fluorescence detector, the instrument will automatically heat up to 38°C for incubation, and the result can be interpreted by observing the fluorescence curve within 5-20 minutes.
[0032] Result determination: the fluorescence curve of the reaction tube containing Schistosoma...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap