Schistosoma japonicum nucleic acid detection kit based on RPA and detection method

A technology for schistosomiasis nucleic acid and detection kit, which is applied in biochemical equipment and methods, microbial determination/inspection, etc., can solve problems such as product pollution to the environment, negative control produces positive results, etc., and achieves the effect of simple and convenient result judgment.

Active Publication Date: 2016-06-08
INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

PCR and Q-PCR methods rely on thermal cyclers and have high requirements on the operating environment and personnel. However, a major pro...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Schistosoma japonicum nucleic acid detection kit based on RPA and detection method
  • Schistosoma japonicum nucleic acid detection kit based on RPA and detection method
  • Schistosoma japonicum nucleic acid detection kit based on RPA and detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Embodiment 1 template, the preparation of primer and probe

[0026] Genomic DNA extraction: Oncomelania, patient feces, blood, etc., use corresponding nucleic acid extraction methods or genome extraction kits to complete the extraction of genomic DNA. Primer design: Download the nucleic acid sequence from Genebank, select the SjR2 segment of the conservative repeat of Schistosoma japonicum, and design and synthesize RPA primers and probes. RPA reaction primer F1: CCAAGTCTCAGTGAAGTTGTGAAGGCTAT; R1: GTTAGTGTTCGAGACCAGTCAGATGGGATT; RPA reaction probe: CTTAAAGCGAGGGAGAGCGGCAGGACCAGA(dT-FAM)G(THF)A(dT-BHQ1)TGACCCTGAGATAT[3'-block]. The dT near the 5' end (31bp) is labeled with FAM, and the dT near the 3' end (33bp) is labeled with BHQ1. Primers and probes were synthesized by Shanghai Sangong.

Embodiment 2

[0027] Embodiment 2 reaction system and identification method

[0028]Reaction system: add 29.5 μL Rehydration Buffer, 2.1 μL 10 μM PrimerA (RPA reaction primer F1) and 2.1 μL 10 μM PrimerB to RPA freeze-dried particles (phage recombinase UvsX and its cofactor UvsY, DNA polymerase, single-stranded DNA binding protein (gp32), dNTPS) (RPA reaction primer R1), 0.6 μL of 10 μM probe, 10.7 μL of double distilled water, 2.5 μL of template, add 2.5 μL of magnesium acetate on the reaction tube cap, carefully cover the tube cap tightly and centrifuge to mix the magnesium acetate with the solution, and reverse the reaction upside down The tube was thoroughly mixed and then centrifuged again, placed in the TwistDX fluorescence detector, the instrument was automatically heated to 38°C for incubation, and the result could be interpreted by observing the fluorescence curve within 5-20 minutes.

[0029] Result judgment: the fluorescence curve of the reaction tube containing Schistosoma japon...

Embodiment 3

[0030] Embodiment 3RPA primer specificity analysis

[0031] Reaction system: Add 29.5 μL RehydrationBuffer, 2.1 μL 10 μM PrimerA (reaction primer F1: TCTAATGCTATTGGTTTGAGT) to RPA freeze-dried particles (phage recombinase UvsX and its cofactor UvsY, DNA polymerase, single-stranded DNA binding protein (gp32), dNTPS), 2.1 μL 10 μM Primer B (reaction primer R1: TTCCTTATTTTCACAAGGTGA), 0.6 μL 10 μM probe, 10.7 μL double distilled water, 2.5 μL template, add 2.5 μL magnesium acetate on the cap of the reaction tube, carefully close the tube cap and centrifuge to mix the magnesium acetate with the solution, up and down Invert the reaction tube to make it fully mixed and centrifuge again, place it in the TwistDX fluorescence detector, the instrument will automatically heat up to 38°C for incubation, and the result can be interpreted by observing the fluorescence curve within 5-20 minutes.

[0032] Result determination: the fluorescence curve of the reaction tube containing Schistosoma...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a schistosoma japonicum nucleic acid detection kit based on RPA and a detection method, and belongs to the field of biotechnology. The kit comprises RPA freeze-dried particles, a buffer solution, magnesium acetate, RPA reaction primers and an RPA reaction probe. According to the schistosoma japonicum nucleic acid detection kit based on the RPA and the detection method, the RPA technology is utilized to establish the detection method of schistosoma japonicum, the sensitivity and specificity are equivalent to those of a Q-PCR method and far higher than those of a Kato-Katz method, a miracidium incubation method, an ELISA and an IHA, the whole reaction is completed within 10-20 min, and the result is determined only through changes of a fluorescent curve. The detection kit has the advantages that the sensitivity and specificity are achieved, and the result is easy, convenient and rapid to determine. The detection kit not only can be suitable for bedside diagnosis, but also can be used for field study and environmental assessment.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to an RPA-based nucleic acid detection kit and detection method for Schistosoma japonicum. Background technique [0002] Schistosomiasis is the second largest parasitic disease in the world. It is a zoonotic parasitic disease and is prevalent in 76 countries and regions in Asia, Africa and Latin America. It is one of the important public health problems in the world. There are mainly 6 kinds of schistosomiasis that parasitize the human body, among which schistosomiasis, which is prevalent in my country, is the most serious hazard to human health and the most difficult to control. Schistosomiasis not only affects personal health, but also affects the economic development of the entire schistosomiasis endemic area. In 2004, my country listed it as a Class B infectious disease, and it is in the same important position of prevention and treatment as SARS and AIDS. [0003] Sch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/68
CPCC12Q1/6844C12Q2521/507C12Q2521/101C12Q2522/101
Inventor 邢微微徐东刚孙魁王园园冯惊涛喻鑫玲罗志宏毛金武付文亮
Owner INST OF BASIC MEDICAL SCI ACAD OF MILITARY MEDICAL SCI OF PLA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap