Method for improving rice yield through OsGRF6 gene, and applications thereof
A rice and gene technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc., can solve problems such as no research reports, and achieve the effect of huge application potential.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0044] 1. Obtaining the full-length fragment of the GRF6 gene
[0045]Using KOME full-length cDNA clone (AK073578) as a template (purchased from GenomeResource Center, National Institute of Agrobiological Science, Japan), design primer pair G6F / G6R and add attB recombination site (Invitrogen) at the respective 5' ends. The primer sequences are shown in Table 2, and PCR amplification The obtained product is sequenced and analyzed, and the nucleotide sequence of the amplified gene fragment is shown in SEQ ID NO.4, and the structure diagram of the GRF6 gene is shown in figure 1 shown.
[0046] Table 2. Primer sequences
[0047] Primer name
Primer sequence (5'-3')
G6F
ATGCAGGGTGCAATGGCCAGGGTGA
G6R
TCACACCAGGCGGATGCTCGGATG
[0048] 2. Construction of GRF6 gene overexpression vector
[0049] The product amplified with the primer pair G6F / G6R was inserted into the expression vector pH7WG2D through BP and LR two-step reaction (Invitrogen) t...
Embodiment 2
[0062] 1. Obtaining the GRF6 gene interference fragment
[0063] Using the KOME full-length cDNA clone (AK073578) as a template (purchased from GenomeResource Center, Japan, National Institute of AgrobiologicalScience), design primer pair R6F / R6R and add attB recombination site (Invitrogen) at the respective 5' ends. The primer sequences are shown in Table 4, and PCR amplification The obtained product was subjected to sequencing analysis, and the nucleotide sequence of the amplified gene fragment was shown in SEQ ID NO.5.
[0064] Table 4. Primer sequences
[0065] Primer name
Primer sequence (5'-3')
R6F
TCCATTAGCACGAGAAA
R6R
AAAGAATCACGGAACATAG
[0066] 2. Construction of GRF6 gene interference vector
[0067] The product amplified with primer pair R6F / R6R was inserted into the expression vector pANIC8A (http: / / plantsciences.utk.edu / stewart_panic.htm; MannDGJetal., PlantBiotechJ10:226-236) through BP and LR two-step reaction (Invitr...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com