Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Complex soil remediation agent and application thereof to remedying greenhouse soil

A soil remediation and greenhouse technology, applied in the restoration of polluted soil, microorganism-based methods, microorganisms, etc., can solve problems such as unreported, achieve wide application value, improve and activate soil, and reduce pesticide residues.

Active Publication Date: 2016-02-03
新疆惠森生物技术有限公司
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are many reports on the study of the effects of organic materials on soil properties and crop yields in the field, the isolation and screening of strains that can improve greenhouse soil from greenhouse soil, and the use of self-selection to screen domesticated subtilis spores Bacillus, Geotrichum candidum, Streptomyces flavinus and other strains have not been reported in the preparation of soil remediation agents based on the compatibility, applicability and safety of the strains and the characteristics of the strains to improve the soil in greenhouses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Complex soil remediation agent and application thereof to remedying greenhouse soil
  • Complex soil remediation agent and application thereof to remedying greenhouse soil
  • Complex soil remediation agent and application thereof to remedying greenhouse soil

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Example 1: Molecular level of Bacillus Subtilis (Bacillus Subtilis) XHS0035KcCGMCCNO.9434

[0036] 1. PCR amplification of the 16SrDNA sequence of Bacillus subtilis and its sequencing

[0037] Pick a small amount of single colonies of the XHS0035Kc strain, put them into an EP tube filled with 25 μL of sterile water, boil at 100°C for 8-10 minutes, and then quickly put them into the ice-water mixture for 5 minutes. Centrifuge at 10000r / min for 5min, store at 4°C, and take the supernatant when used.

[0038] Determination of 16SrDNA gene sequence and construction of phylogenetic tree: Extract the total DNA of the strain according to conventional methods, dilute the universal primers with deionized water, and perform PCR amplification. The primers are designed as follows:

[0039] 27f:AGAGTTTGATCCTGGCTCAG

[0040] 1492r:TACGGCTACCTTGTTACGACTT

[0041] Determination of 16SrRNA gene sequence and construction of phylogenetic tree: extract the total DNA of bacterial strains...

Embodiment 2

[0044] Example 2: Molecular level of Geotrichum Candidum XHS0030BCGMCCNO.9435

[0045] 1. PCR amplification of the ITSrDNA sequence of Geotrichum candidum and its sequencing

[0046] Pick a small amount of single colonies of the XHS0030B strain, put them into an EP tube filled with 25 μL of sterile water, boil at 100°C for 8-10 minutes, and then quickly put them into the ice-water mixture for 5 minutes. Centrifuge at 10000r / min for 5min, store at 4°C, and take the supernatant when used.

[0047] The construction of ITSrDNA gene sequence determination and phylogenetic tree thereof: extract the total DNA of bacterial strain according to routine method, carry out the PCR amplification of ITSrDNA section with deionized water with the dilution universal primer ITS1 and ITS4, primer design is as follows:

[0048] ITS1(F): 5'-TCCGTAGGTGAACCTGCGG-3'

[0049] ITS4(R): 5'-TCCTCCGCTTATTGATATGC-3'

[0050] The 50 μl reaction system contains: 5 μl of 10×PCR buffer, 20 pmol of each prime...

Embodiment 3

[0053] Example 3: Molecular level of Streptomyces microflavus XHS0032XhCGMCCNO.9432

[0054] 1. PCR amplification of the 16SrDNA sequence of Streptomyces flavinus and its sequencing

[0055] Pick a small amount of single colonies of the XHS0032Xh strain, put them into an EP tube filled with 25 μL of sterile water, boil at 100°C for 8-10 minutes, and then quickly put them into the ice-water mixture for 5 minutes. Centrifuge at 10000r / min for 5min, store at 4°C, and take the supernatant when used.

[0056] Determination of 16SrDNA gene sequence and construction of phylogenetic tree: Extract the total DNA of the strain according to conventional methods, dilute the universal primers with deionized water, and perform PCR amplification. The primers are designed as follows:

[0057] 27f:AGAGTTTGATCCTGGCTCAG

[0058] 1492r:TACGGCTACCTTGTTACGACTT

[0059] Determination of 16SrRNA gene sequence and construction of phylogenetic tree: extract the total DNA of the strain according to co...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a complex soil remediation agent and application thereof to remedying greenhouse soil. Bacillus subtillis XHS0035Kc with a number of CGMCC NO.9434, geotrichum candidum XHS0030B with a number of CGMCC NO.9435 and streptomyces microflavus XHSOO32Xh with a number of CGMCC NO.9432 are obtained by means of separating and screening and are mixed with 20%-25% of rhodopseudomonas palustris according to proportions of 20%-25%, 15%-20% and 30%-35%, and strain mixed liquid is sufficiently adsorbed in carriers and is mixed with accessories, so that the complex soil remediation agent can be prepared by means of fermentation. The complex soil remediation agent and the application have the advantage that outstanding technical effects can be realized by the complex soil remediation agent for remedying the greenhouse soil.

Description

technical field [0001] The invention relates to the technical field of application of agricultural microorganisms, in particular to the technical field of self-selected and screened strains to prepare composite soil remediation agents and their application in greenhouse soil remediation. Background technique [0002] With the continuous development of facility agriculture, more and more chemical fertilizers, pesticides and other chemical substances are accumulated in the farmland, resulting in soil compaction and many diseases that directly affect the yield and quality of agricultural products. This problem has become an urgent problem for the planting industry to overcome. . At present, some domestic companies that deal with polluted soil mostly use physical and chemical methods for treatment. Among them, physical methods mostly use incineration and landfill to deal with pollutants, which are easy to damage the soil structure, and the treatment process is cumbersome and cos...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20C12N1/14B09C1/10C12R1/125C12R1/645C12R1/465C12R1/01
Inventor 王心歌张松林韩友青苏玲
Owner 新疆惠森生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com