Complex soil remediation agent and application thereof to remedying greenhouse soil
A soil remediation and greenhouse technology, applied in the restoration of polluted soil, microorganism-based methods, microorganisms, etc., can solve problems such as unreported, achieve wide application value, improve and activate soil, and reduce pesticide residues.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0035] Example 1: Molecular level of Bacillus Subtilis (Bacillus Subtilis) XHS0035KcCGMCCNO.9434
[0036] 1. PCR amplification of the 16SrDNA sequence of Bacillus subtilis and its sequencing
[0037] Pick a small amount of single colonies of the XHS0035Kc strain, put them into an EP tube filled with 25 μL of sterile water, boil at 100°C for 8-10 minutes, and then quickly put them into the ice-water mixture for 5 minutes. Centrifuge at 10000r / min for 5min, store at 4°C, and take the supernatant when used.
[0038] Determination of 16SrDNA gene sequence and construction of phylogenetic tree: Extract the total DNA of the strain according to conventional methods, dilute the universal primers with deionized water, and perform PCR amplification. The primers are designed as follows:
[0039] 27f:AGAGTTTGATCCTGGCTCAG
[0040] 1492r:TACGGCTACCTTGTTACGACTT
[0041] Determination of 16SrRNA gene sequence and construction of phylogenetic tree: extract the total DNA of bacterial strains...
Embodiment 2
[0044] Example 2: Molecular level of Geotrichum Candidum XHS0030BCGMCCNO.9435
[0045] 1. PCR amplification of the ITSrDNA sequence of Geotrichum candidum and its sequencing
[0046] Pick a small amount of single colonies of the XHS0030B strain, put them into an EP tube filled with 25 μL of sterile water, boil at 100°C for 8-10 minutes, and then quickly put them into the ice-water mixture for 5 minutes. Centrifuge at 10000r / min for 5min, store at 4°C, and take the supernatant when used.
[0047] The construction of ITSrDNA gene sequence determination and phylogenetic tree thereof: extract the total DNA of bacterial strain according to routine method, carry out the PCR amplification of ITSrDNA section with deionized water with the dilution universal primer ITS1 and ITS4, primer design is as follows:
[0048] ITS1(F): 5'-TCCGTAGGTGAACCTGCGG-3'
[0049] ITS4(R): 5'-TCCTCCGCTTATTGATATGC-3'
[0050] The 50 μl reaction system contains: 5 μl of 10×PCR buffer, 20 pmol of each prime...
Embodiment 3
[0053] Example 3: Molecular level of Streptomyces microflavus XHS0032XhCGMCCNO.9432
[0054] 1. PCR amplification of the 16SrDNA sequence of Streptomyces flavinus and its sequencing
[0055] Pick a small amount of single colonies of the XHS0032Xh strain, put them into an EP tube filled with 25 μL of sterile water, boil at 100°C for 8-10 minutes, and then quickly put them into the ice-water mixture for 5 minutes. Centrifuge at 10000r / min for 5min, store at 4°C, and take the supernatant when used.
[0056] Determination of 16SrDNA gene sequence and construction of phylogenetic tree: Extract the total DNA of the strain according to conventional methods, dilute the universal primers with deionized water, and perform PCR amplification. The primers are designed as follows:
[0057] 27f:AGAGTTTGATCCTGGCTCAG
[0058] 1492r:TACGGCTACCTTGTTACGACTT
[0059] Determination of 16SrRNA gene sequence and construction of phylogenetic tree: extract the total DNA of the strain according to co...
PUM
![No PUM](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka-patsnap-com.libproxy1.nus.edu.sg/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap